ID: 1086015712

View in Genome Browser
Species Human (GRCh38)
Location 11:82164774-82164796
Sequence TTCCATAAACTTGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086015708_1086015712 -5 Left 1086015708 11:82164756-82164778 CCTATCTTACTGAAACTATTCCA 0: 66
1: 319
2: 1303
3: 11198
4: 5996
Right 1086015712 11:82164774-82164796 TTCCATAAACTTGAGGAGGAGGG No data
1086015707_1086015712 20 Left 1086015707 11:82164731-82164753 CCAGATGTACAAAGAAGAGATGC No data
Right 1086015712 11:82164774-82164796 TTCCATAAACTTGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086015712 Original CRISPR TTCCATAAACTTGAGGAGGA GGG Intergenic
No off target data available for this crispr