ID: 1086038448

View in Genome Browser
Species Human (GRCh38)
Location 11:82445135-82445157
Sequence GAGCCAGAGGAGGAGCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086038448_1086038454 19 Left 1086038448 11:82445135-82445157 CCTAACAGCTCCTCCTCTGGCTC No data
Right 1086038454 11:82445177-82445199 AATGCTCCAAAGCCAATGCATGG No data
1086038448_1086038451 -10 Left 1086038448 11:82445135-82445157 CCTAACAGCTCCTCCTCTGGCTC No data
Right 1086038451 11:82445148-82445170 CCTCTGGCTCTCCCTGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086038448 Original CRISPR GAGCCAGAGGAGGAGCTGTT AGG (reversed) Intergenic
No off target data available for this crispr