ID: 1086045462

View in Genome Browser
Species Human (GRCh38)
Location 11:82526662-82526684
Sequence CTGTTATGATGGAGCTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086045462_1086045466 29 Left 1086045462 11:82526662-82526684 CCTTGGTAGCTCCATCATAACAG No data
Right 1086045466 11:82526714-82526736 AATTGTCTTTCCTCCTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086045462 Original CRISPR CTGTTATGATGGAGCTACCA AGG (reversed) Intergenic
No off target data available for this crispr