ID: 1086049394

View in Genome Browser
Species Human (GRCh38)
Location 11:82571226-82571248
Sequence CTACCATAACTTTTGTAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086049390_1086049394 20 Left 1086049390 11:82571183-82571205 CCTTTATTTCTTTCTCTTGCCTG 0: 2319
1: 4498
2: 6067
3: 6174
4: 3409
Right 1086049394 11:82571226-82571248 CTACCATAACTTTTGTAACATGG No data
1086049389_1086049394 21 Left 1086049389 11:82571182-82571204 CCCTTTATTTCTTTCTCTTGCCT 0: 2791
1: 5828
2: 10697
3: 4557
4: 4309
Right 1086049394 11:82571226-82571248 CTACCATAACTTTTGTAACATGG No data
1086049392_1086049394 1 Left 1086049392 11:82571202-82571224 CCTGATTGCTTTTGCTAGGACTT No data
Right 1086049394 11:82571226-82571248 CTACCATAACTTTTGTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086049394 Original CRISPR CTACCATAACTTTTGTAACA TGG Intergenic
No off target data available for this crispr