ID: 1086056600

View in Genome Browser
Species Human (GRCh38)
Location 11:82654217-82654239
Sequence ACTAGGCAGTGCCCCAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086056600_1086056604 -5 Left 1086056600 11:82654217-82654239 CCTTTACTGGGGCACTGCCTAGT No data
Right 1086056604 11:82654235-82654257 CTAGTGGAGCTGTGAGAAGAGGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701
1086056600_1086056607 21 Left 1086056600 11:82654217-82654239 CCTTTACTGGGGCACTGCCTAGT No data
Right 1086056607 11:82654261-82654283 CCATCCTCCAGACCCCACAATGG 0: 12
1: 783
2: 1287
3: 1608
4: 1542
1086056600_1086056603 -6 Left 1086056600 11:82654217-82654239 CCTTTACTGGGGCACTGCCTAGT No data
Right 1086056603 11:82654234-82654256 CCTAGTGGAGCTGTGAGAAGAGG 0: 1581
1: 2034
2: 1486
3: 837
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086056600 Original CRISPR ACTAGGCAGTGCCCCAGTAA AGG (reversed) Intergenic
No off target data available for this crispr