ID: 1086060264

View in Genome Browser
Species Human (GRCh38)
Location 11:82693093-82693115
Sequence CACCTTTGGAAGCAGAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086060264_1086060266 17 Left 1086060264 11:82693093-82693115 CCTTGTCTCTGCTTCCAAAGGTG No data
Right 1086060266 11:82693133-82693155 TCACACAGTAGAAGAGACAAAGG No data
1086060264_1086060267 27 Left 1086060264 11:82693093-82693115 CCTTGTCTCTGCTTCCAAAGGTG No data
Right 1086060267 11:82693143-82693165 GAAGAGACAAAGGAGACAAAAGG No data
1086060264_1086060268 28 Left 1086060264 11:82693093-82693115 CCTTGTCTCTGCTTCCAAAGGTG No data
Right 1086060268 11:82693144-82693166 AAGAGACAAAGGAGACAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086060264 Original CRISPR CACCTTTGGAAGCAGAGACA AGG (reversed) Intergenic
No off target data available for this crispr