ID: 1086062374

View in Genome Browser
Species Human (GRCh38)
Location 11:82713127-82713149
Sequence AGAAAAGAAGGTTTTGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086062370_1086062374 6 Left 1086062370 11:82713098-82713120 CCTCTGCACTGAAGTTCCAACCT 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1086062374 11:82713127-82713149 AGAAAAGAAGGTTTTGTGAATGG No data
1086062369_1086062374 7 Left 1086062369 11:82713097-82713119 CCCTCTGCACTGAAGTTCCAACC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086062374 11:82713127-82713149 AGAAAAGAAGGTTTTGTGAATGG No data
1086062371_1086062374 -10 Left 1086062371 11:82713114-82713136 CCAACCTAAAAAAAGAAAAGAAG 0: 1
1: 2
2: 54
3: 623
4: 6888
Right 1086062374 11:82713127-82713149 AGAAAAGAAGGTTTTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086062374 Original CRISPR AGAAAAGAAGGTTTTGTGAA TGG Intergenic