ID: 1086063181

View in Genome Browser
Species Human (GRCh38)
Location 11:82721036-82721058
Sequence TCTCAGGATTTAAAAGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086063181_1086063192 27 Left 1086063181 11:82721036-82721058 CCAGTACCTTTTAAATCCTGAGA No data
Right 1086063192 11:82721086-82721108 TCCTCATTGGATGCAAAAGAGGG No data
1086063181_1086063191 26 Left 1086063181 11:82721036-82721058 CCAGTACCTTTTAAATCCTGAGA No data
Right 1086063191 11:82721085-82721107 TTCCTCATTGGATGCAAAAGAGG No data
1086063181_1086063183 -10 Left 1086063181 11:82721036-82721058 CCAGTACCTTTTAAATCCTGAGA No data
Right 1086063183 11:82721049-82721071 AATCCTGAGATGAAAATCCCAGG No data
1086063181_1086063184 -9 Left 1086063181 11:82721036-82721058 CCAGTACCTTTTAAATCCTGAGA No data
Right 1086063184 11:82721050-82721072 ATCCTGAGATGAAAATCCCAGGG No data
1086063181_1086063188 14 Left 1086063181 11:82721036-82721058 CCAGTACCTTTTAAATCCTGAGA No data
Right 1086063188 11:82721073-82721095 CACCCAGAGCTCTTCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086063181 Original CRISPR TCTCAGGATTTAAAAGGTAC TGG (reversed) Intergenic
No off target data available for this crispr