ID: 1086063185

View in Genome Browser
Species Human (GRCh38)
Location 11:82721052-82721074
Sequence TGCCCTGGGATTTTCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086063185_1086063188 -2 Left 1086063185 11:82721052-82721074 CCTGAGATGAAAATCCCAGGGCA No data
Right 1086063188 11:82721073-82721095 CACCCAGAGCTCTTCCTCATTGG No data
1086063185_1086063192 11 Left 1086063185 11:82721052-82721074 CCTGAGATGAAAATCCCAGGGCA No data
Right 1086063192 11:82721086-82721108 TCCTCATTGGATGCAAAAGAGGG No data
1086063185_1086063191 10 Left 1086063185 11:82721052-82721074 CCTGAGATGAAAATCCCAGGGCA No data
Right 1086063191 11:82721085-82721107 TTCCTCATTGGATGCAAAAGAGG No data
1086063185_1086063194 17 Left 1086063185 11:82721052-82721074 CCTGAGATGAAAATCCCAGGGCA No data
Right 1086063194 11:82721092-82721114 TTGGATGCAAAAGAGGGACCAGG No data
1086063185_1086063195 27 Left 1086063185 11:82721052-82721074 CCTGAGATGAAAATCCCAGGGCA No data
Right 1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086063185 Original CRISPR TGCCCTGGGATTTTCATCTC AGG (reversed) Intergenic
No off target data available for this crispr