ID: 1086063186

View in Genome Browser
Species Human (GRCh38)
Location 11:82721066-82721088
Sequence GGAAGAGCTCTGGGTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086063186_1086063192 -3 Left 1086063186 11:82721066-82721088 CCCAGGGCACCCAGAGCTCTTCC No data
Right 1086063192 11:82721086-82721108 TCCTCATTGGATGCAAAAGAGGG No data
1086063186_1086063195 13 Left 1086063186 11:82721066-82721088 CCCAGGGCACCCAGAGCTCTTCC No data
Right 1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG No data
1086063186_1086063191 -4 Left 1086063186 11:82721066-82721088 CCCAGGGCACCCAGAGCTCTTCC No data
Right 1086063191 11:82721085-82721107 TTCCTCATTGGATGCAAAAGAGG No data
1086063186_1086063194 3 Left 1086063186 11:82721066-82721088 CCCAGGGCACCCAGAGCTCTTCC No data
Right 1086063194 11:82721092-82721114 TTGGATGCAAAAGAGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086063186 Original CRISPR GGAAGAGCTCTGGGTGCCCT GGG (reversed) Intergenic
No off target data available for this crispr