ID: 1086063188

View in Genome Browser
Species Human (GRCh38)
Location 11:82721073-82721095
Sequence CACCCAGAGCTCTTCCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086063185_1086063188 -2 Left 1086063185 11:82721052-82721074 CCTGAGATGAAAATCCCAGGGCA No data
Right 1086063188 11:82721073-82721095 CACCCAGAGCTCTTCCTCATTGG No data
1086063182_1086063188 8 Left 1086063182 11:82721042-82721064 CCTTTTAAATCCTGAGATGAAAA No data
Right 1086063188 11:82721073-82721095 CACCCAGAGCTCTTCCTCATTGG No data
1086063181_1086063188 14 Left 1086063181 11:82721036-82721058 CCAGTACCTTTTAAATCCTGAGA No data
Right 1086063188 11:82721073-82721095 CACCCAGAGCTCTTCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086063188 Original CRISPR CACCCAGAGCTCTTCCTCAT TGG Intergenic
No off target data available for this crispr