ID: 1086063189

View in Genome Browser
Species Human (GRCh38)
Location 11:82721075-82721097
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086063189_1086063197 28 Left 1086063189 11:82721075-82721097 CCCAGAGCTCTTCCTCATTGGAT No data
Right 1086063197 11:82721126-82721148 TCTTTTTCAGCTCTCTCCTGAGG No data
1086063189_1086063194 -6 Left 1086063189 11:82721075-82721097 CCCAGAGCTCTTCCTCATTGGAT No data
Right 1086063194 11:82721092-82721114 TTGGATGCAAAAGAGGGACCAGG No data
1086063189_1086063195 4 Left 1086063189 11:82721075-82721097 CCCAGAGCTCTTCCTCATTGGAT No data
Right 1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086063189 Original CRISPR ATCCAATGAGGAAGAGCTCT GGG (reversed) Intergenic
No off target data available for this crispr