ID: 1086063190

View in Genome Browser
Species Human (GRCh38)
Location 11:82721076-82721098
Sequence CATCCAATGAGGAAGAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086063190_1086063195 3 Left 1086063190 11:82721076-82721098 CCAGAGCTCTTCCTCATTGGATG No data
Right 1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG No data
1086063190_1086063197 27 Left 1086063190 11:82721076-82721098 CCAGAGCTCTTCCTCATTGGATG No data
Right 1086063197 11:82721126-82721148 TCTTTTTCAGCTCTCTCCTGAGG No data
1086063190_1086063194 -7 Left 1086063190 11:82721076-82721098 CCAGAGCTCTTCCTCATTGGATG No data
Right 1086063194 11:82721092-82721114 TTGGATGCAAAAGAGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086063190 Original CRISPR CATCCAATGAGGAAGAGCTC TGG (reversed) Intergenic
No off target data available for this crispr