ID: 1086063191

View in Genome Browser
Species Human (GRCh38)
Location 11:82721085-82721107
Sequence TTCCTCATTGGATGCAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086063181_1086063191 26 Left 1086063181 11:82721036-82721058 CCAGTACCTTTTAAATCCTGAGA No data
Right 1086063191 11:82721085-82721107 TTCCTCATTGGATGCAAAAGAGG No data
1086063187_1086063191 -5 Left 1086063187 11:82721067-82721089 CCAGGGCACCCAGAGCTCTTCCT No data
Right 1086063191 11:82721085-82721107 TTCCTCATTGGATGCAAAAGAGG No data
1086063182_1086063191 20 Left 1086063182 11:82721042-82721064 CCTTTTAAATCCTGAGATGAAAA No data
Right 1086063191 11:82721085-82721107 TTCCTCATTGGATGCAAAAGAGG No data
1086063185_1086063191 10 Left 1086063185 11:82721052-82721074 CCTGAGATGAAAATCCCAGGGCA No data
Right 1086063191 11:82721085-82721107 TTCCTCATTGGATGCAAAAGAGG No data
1086063186_1086063191 -4 Left 1086063186 11:82721066-82721088 CCCAGGGCACCCAGAGCTCTTCC No data
Right 1086063191 11:82721085-82721107 TTCCTCATTGGATGCAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086063191 Original CRISPR TTCCTCATTGGATGCAAAAG AGG Intergenic
No off target data available for this crispr