ID: 1086063195

View in Genome Browser
Species Human (GRCh38)
Location 11:82721102-82721124
Sequence AAGAGGGACCAGGAAGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086063186_1086063195 13 Left 1086063186 11:82721066-82721088 CCCAGGGCACCCAGAGCTCTTCC No data
Right 1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG No data
1086063187_1086063195 12 Left 1086063187 11:82721067-82721089 CCAGGGCACCCAGAGCTCTTCCT No data
Right 1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG No data
1086063185_1086063195 27 Left 1086063185 11:82721052-82721074 CCTGAGATGAAAATCCCAGGGCA No data
Right 1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG No data
1086063193_1086063195 -8 Left 1086063193 11:82721087-82721109 CCTCATTGGATGCAAAAGAGGGA No data
Right 1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG No data
1086063190_1086063195 3 Left 1086063190 11:82721076-82721098 CCAGAGCTCTTCCTCATTGGATG No data
Right 1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG No data
1086063189_1086063195 4 Left 1086063189 11:82721075-82721097 CCCAGAGCTCTTCCTCATTGGAT No data
Right 1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086063195 Original CRISPR AAGAGGGACCAGGAAGTTCA AGG Intergenic
No off target data available for this crispr