ID: 1086070745

View in Genome Browser
Species Human (GRCh38)
Location 11:82796322-82796344
Sequence CACAGTAACGAGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086070745_1086070749 5 Left 1086070745 11:82796322-82796344 CCTCCTTCCTTCTCGTTACTGTG No data
Right 1086070749 11:82796350-82796372 ATTGTCTTTACTCCTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086070745 Original CRISPR CACAGTAACGAGAAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr