ID: 1086071390

View in Genome Browser
Species Human (GRCh38)
Location 11:82803476-82803498
Sequence CTTTCTGTTCAGAGGTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086071390_1086071398 14 Left 1086071390 11:82803476-82803498 CCAAGGGACCTCTGAACAGAAAG No data
Right 1086071398 11:82803513-82803535 CTTGACCCAGGAGGCCAACAGGG No data
1086071390_1086071393 2 Left 1086071390 11:82803476-82803498 CCAAGGGACCTCTGAACAGAAAG No data
Right 1086071393 11:82803501-82803523 ATATTTGACCCACTTGACCCAGG No data
1086071390_1086071399 15 Left 1086071390 11:82803476-82803498 CCAAGGGACCTCTGAACAGAAAG No data
Right 1086071399 11:82803514-82803536 TTGACCCAGGAGGCCAACAGGGG No data
1086071390_1086071402 23 Left 1086071390 11:82803476-82803498 CCAAGGGACCTCTGAACAGAAAG No data
Right 1086071402 11:82803522-82803544 GGAGGCCAACAGGGGAAGAATGG No data
1086071390_1086071397 13 Left 1086071390 11:82803476-82803498 CCAAGGGACCTCTGAACAGAAAG No data
Right 1086071397 11:82803512-82803534 ACTTGACCCAGGAGGCCAACAGG No data
1086071390_1086071394 5 Left 1086071390 11:82803476-82803498 CCAAGGGACCTCTGAACAGAAAG No data
Right 1086071394 11:82803504-82803526 TTTGACCCACTTGACCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086071390 Original CRISPR CTTTCTGTTCAGAGGTCCCT TGG (reversed) Intergenic
No off target data available for this crispr