ID: 1086072039

View in Genome Browser
Species Human (GRCh38)
Location 11:82810556-82810578
Sequence CTGTGGCAGGCACTGTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086072039_1086072043 9 Left 1086072039 11:82810556-82810578 CCATAACACAGTGCCTGCCACAG No data
Right 1086072043 11:82810588-82810610 TCTGTATTGAGTAAATAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086072039 Original CRISPR CTGTGGCAGGCACTGTGTTA TGG (reversed) Intergenic
No off target data available for this crispr