ID: 1086072233

View in Genome Browser
Species Human (GRCh38)
Location 11:82812087-82812109
Sequence CCCATTTGATAGTCTTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086072233_1086072238 22 Left 1086072233 11:82812087-82812109 CCATGCCAAGACTATCAAATGGG No data
Right 1086072238 11:82812132-82812154 CCCAAATGCTGTGGTCTTCTTGG No data
1086072233_1086072236 13 Left 1086072233 11:82812087-82812109 CCATGCCAAGACTATCAAATGGG No data
Right 1086072236 11:82812123-82812145 GTTAATTTTCCCAAATGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086072233 Original CRISPR CCCATTTGATAGTCTTGGCA TGG (reversed) Intergenic
No off target data available for this crispr