ID: 1086073542

View in Genome Browser
Species Human (GRCh38)
Location 11:82825331-82825353
Sequence ACGCCTCCTTCAATTATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086073542_1086073545 5 Left 1086073542 11:82825331-82825353 CCAGAGATAATTGAAGGAGGCGT 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1086073545 11:82825359-82825381 CAAATCAACCTAGACTGTACTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1086073542_1086073546 6 Left 1086073542 11:82825331-82825353 CCAGAGATAATTGAAGGAGGCGT 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1086073546 11:82825360-82825382 AAATCAACCTAGACTGTACTGGG 0: 1
1: 0
2: 1
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086073542 Original CRISPR ACGCCTCCTTCAATTATCTC TGG (reversed) Intronic
904651195 1:32007227-32007249 AAGTCTCCTTCAAGTATTTCTGG + Intergenic
923054608 1:230416668-230416690 ACGCGTCCTACCATTGTCTCTGG - Intronic
1063922837 10:10949052-10949074 TCACCTCCTCCAATTCTCTCTGG - Intergenic
1065129986 10:22610789-22610811 AGGCTTCCTTCAAGGATCTCAGG - Intronic
1068969335 10:62946429-62946451 TTGCCTCCTTCAATCATTTCTGG + Intergenic
1070148231 10:73789841-73789863 CCCCCTCCTGCAATTAGCTCCGG + Intronic
1078685459 11:13526389-13526411 ATGCCTCCTTCTACTACCTCGGG + Intergenic
1083323232 11:61860329-61860351 AAGCCTCCTTCAAAGATCTTAGG - Intronic
1086073542 11:82825331-82825353 ACGCCTCCTTCAATTATCTCTGG - Intronic
1094196192 12:27752214-27752236 CCTCCTCCTTCATTCATCTCAGG - Intronic
1098338689 12:69429642-69429664 TTACCTCTTTCAATTATCTCAGG - Intergenic
1101898580 12:108774153-108774175 GCGCCTCCTTCAATGAGCTCAGG + Intergenic
1107496755 13:40933786-40933808 TCTCCTCCTTCAATTGTCTTGGG - Exonic
1111175490 13:84589995-84590017 ACGTTTCCTTCAATACTCTCTGG - Intergenic
1138785318 16:59838750-59838772 AAGCCTCTTTCAATAGTCTCAGG - Intergenic
1140936406 16:79674666-79674688 TCTCCTCTTTCAATAATCTCTGG - Intergenic
1141281863 16:82636173-82636195 AGGCCTCCTTCACCTCTCTCTGG - Intronic
1157990616 18:52491580-52491602 ATGCCTTCTTCAATGCTCTCTGG - Intronic
1166654220 19:44598501-44598523 CAGCCTCCTTCAATTATTACTGG + Intergenic
928200188 2:29242957-29242979 AGGACTCCTGCAATTATTTCAGG - Intronic
946755656 2:222944731-222944753 ACTCCTTCTTCAAGTATTTCAGG - Intergenic
947505824 2:230707902-230707924 ACCACTCCTTCCATAATCTCGGG + Intergenic
952057465 3:29465443-29465465 GTTCCTCCTTCTATTATCTCTGG + Intronic
952351685 3:32545035-32545057 AGGCCTCCTTAAATTTTCACTGG - Exonic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
966141043 3:176756302-176756324 ACGCATCCTTCCATGATCACTGG + Intergenic
969694944 4:8729214-8729236 ACGCCCCCTTCCATGAGCTCTGG - Intergenic
980213124 4:129815075-129815097 ATGCCTACTTTAAATATCTCCGG + Intergenic
986789557 5:11146301-11146323 ACGGCTGCTCCAATTATCTAGGG + Intronic
987615030 5:20262430-20262452 ATGTCTCCTTAAATTATGTCAGG + Intronic
1019826623 7:3289829-3289851 ACCCTTCCTTCAAATATTTCTGG + Intergenic
1022470281 7:30677752-30677774 AAGCTTCCTGCAGTTATCTCTGG - Intronic
1023513340 7:40976601-40976623 ACCCCTCCTTCAATTTTTCCAGG + Intergenic
1026192987 7:68146617-68146639 CTGCCTCCTTCAAATATCTCTGG - Intergenic
1027000391 7:74649128-74649150 TCGCTTTCTTCCATTATCTCCGG + Intergenic
1038175190 8:25176018-25176040 AAGCCTCCTTCAGGTATTTCTGG + Intergenic
1038371625 8:26999136-26999158 ACGCTTCCTTTAATTATTTCTGG + Intergenic
1038933241 8:32218833-32218855 AACCATCCTTCATTTATCTCAGG + Intronic
1042435573 8:68760796-68760818 AGTTCTCCTTCCATTATCTCAGG - Intronic
1047282859 8:123460885-123460907 ACGCCTCCTCAACTCATCTCTGG - Intronic
1049484343 8:142845639-142845661 ACACCTCCTTCAAGAATCCCAGG - Intronic
1052220363 9:26014625-26014647 AAGCCTCTTTCAATTTCCTCTGG - Intergenic
1055968334 9:81887194-81887216 AGGTCTCCTTGAATTCTCTCAGG - Intergenic
1186514895 X:10159653-10159675 ATGCCTCCTTCAATTATTGATGG - Intronic
1187328195 X:18311437-18311459 ACCCCTCCTACATTTCTCTCTGG - Intronic
1199513202 X:148646405-148646427 AAGCCTCCTCCAATTAAGTCAGG - Intronic