ID: 1086074232

View in Genome Browser
Species Human (GRCh38)
Location 11:82833278-82833300
Sequence AGGTGCTAGTAGAAGTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086074227_1086074232 4 Left 1086074227 11:82833251-82833273 CCACATGGAGTGATAAGCGGTAT 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1086074232 11:82833278-82833300 AGGTGCTAGTAGAAGTAAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086074232 Original CRISPR AGGTGCTAGTAGAAGTAAGG GGG Intronic
902654432 1:17857842-17857864 AGGTGCAAGGAGAGGTGAGGAGG - Intergenic
902854358 1:19189853-19189875 AGATACTAGGCGAAGTAAGGAGG - Intronic
905420095 1:37836191-37836213 AGGTTCTTGAAAAAGTAAGGTGG + Intronic
907621428 1:55984894-55984916 AGGTGCTACTAAAAGTCAGAAGG - Intergenic
910167717 1:84345202-84345224 AAGTGCTAGAAGATGTGAGGGGG + Intronic
911885843 1:103298375-103298397 AGGGCATAGTAGAAATAAGGAGG - Intergenic
912241198 1:107911115-107911137 ATGTGCTATTAGAAGTTGGGAGG - Intronic
914799787 1:150952367-150952389 AGGTGATAGTAGAGGTAAGAAGG + Intronic
915046812 1:153024243-153024265 AAGTCCAAGTAGAAGTAATGTGG + Intergenic
915644781 1:157261906-157261928 AAGGGCTATTAGAAGTAAGAGGG + Intergenic
916346471 1:163797413-163797435 AGGTGGTAATGTAAGTAAGGGGG - Intergenic
916958535 1:169865540-169865562 AGGAGCTAGCAGAAGAATGGAGG - Intronic
1067820675 10:49526882-49526904 AGGTACTAGTAGAACCTAGGTGG + Intronic
1068951089 10:62778266-62778288 AGGTGCTAGTAACAGCCAGGAGG + Intergenic
1071015576 10:80993567-80993589 AAGTGCTATTAGAAATAAGATGG - Intergenic
1072735977 10:97880054-97880076 AGGTGATGGTAGAAGTGATGGGG + Intronic
1073454719 10:103629591-103629613 AGGTGCAAGTAGAGGTCAGGTGG - Intronic
1075728641 10:124623411-124623433 AGGTGGTCGTCGAAGGAAGGGGG + Exonic
1076587078 10:131556564-131556586 AGGTGCTGGCAGAAGCAAGAAGG - Intergenic
1080409661 11:32011658-32011680 AGGTGCTTGCAGAAGAAGGGAGG + Intronic
1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG + Intergenic
1083823796 11:65187088-65187110 AGTTGCTAGGAGAAGCAAGCAGG - Intronic
1086074232 11:82833278-82833300 AGGTGCTAGTAGAAGTAAGGGGG + Intronic
1087617212 11:100501091-100501113 AGGAGCTGGTGAAAGTAAGGAGG - Intergenic
1089421924 11:118338588-118338610 AGGTGCCACTAGCTGTAAGGAGG - Intergenic
1091798550 12:3310687-3310709 TGGTGGTAATAGAAGGAAGGTGG - Intergenic
1096163240 12:49398424-49398446 AAGTCCTAATAGAAGGAAGGTGG + Intronic
1098933190 12:76445148-76445170 AGGTTCTAATAGCAGTTAGGAGG + Intronic
1099136561 12:78911118-78911140 AGGTGAAAGTAGCACTAAGGTGG + Intronic
1099430131 12:82573464-82573486 AGGAGCTGGAAGAGGTAAGGAGG - Intergenic
1109681594 13:65758526-65758548 TGGTGGTAGTAGAAGCAGGGAGG - Intergenic
1110378994 13:74827913-74827935 AGGTGCAAGAAGAAGAGAGGTGG - Intergenic
1111581532 13:90229978-90230000 AGGTATCAGTAGAAGTAAAGAGG - Intergenic
1114231008 14:20782810-20782832 AGGTGATAGTAGTAGTAATAGGG + Intergenic
1115853553 14:37606132-37606154 AGGTGCTTGAAGAAGTCTGGAGG + Intronic
1116127830 14:40811980-40812002 AGGTTCTAGTAGAATGAAAGTGG + Intergenic
1122477908 14:102024562-102024584 AGGAGCTGGGAGTAGTAAGGTGG + Intronic
1125348084 15:38740112-38740134 ATTTGCTAGTAGAAGAAATGTGG + Intergenic
1126101217 15:45119390-45119412 AGGTGTTACTAGCACTAAGGTGG - Intronic
1131416664 15:92265871-92265893 AGGGGGTAGTAGAATTAAGTGGG - Intergenic
1132868164 16:2104018-2104040 AGGTGCAGGCAGAAGGAAGGGGG + Intronic
1134393216 16:13838956-13838978 AGGAGCTAGTAGAAGCCAGAGGG - Intergenic
1134523610 16:14929106-14929128 AGGTGCAGGCAGAAGGAAGGGGG - Intronic
1134549287 16:15131830-15131852 AGGTGCAGGCAGAAGAAAGGGGG + Intronic
1134719056 16:16370893-16370915 AGGTGCAGGCAGAAGGAAGGGGG - Intergenic
1136854901 16:33647457-33647479 AGGTGCAAGCAGAATTAGGGGGG + Intergenic
1144216904 17:13064218-13064240 TGGTGCTAGTAAAAATAAGATGG + Intergenic
1146545952 17:33738624-33738646 TGGGGATAGTAGAAGTAGGGTGG - Intronic
1146667598 17:34715410-34715432 GGGTGCTAGTGGAAGTCTGGGGG - Intergenic
1147928667 17:43962211-43962233 ATGTGCTATTAGAAGGAATGGGG + Intronic
1152841504 17:82571736-82571758 AGCTGCGCGTAGGAGTAAGGCGG - Exonic
1153736142 18:8069836-8069858 AAGTGCGAGAAGAAGTAAGCTGG + Exonic
1157602166 18:48900917-48900939 GGGTGCTAAGAGAAGCAAGGAGG - Intergenic
1157761858 18:50271300-50271322 AGCTTCTAGAAGAAGTAAGCGGG - Intronic
1159116749 18:64123320-64123342 AGGAGCTAGTGGAAGTAGAGTGG - Intergenic
1163928974 19:20370532-20370554 AGGTGCTTATGGAAGTAAGCAGG - Intergenic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1165923461 19:39313026-39313048 AGGTGAAAGGAGAAATAAGGAGG + Intronic
1166572451 19:43806175-43806197 AGGTGGTAGTACAAGTAATGGGG - Intronic
1166846286 19:45730679-45730701 AGGTAGTAGTAGAAGAATGGTGG - Intronic
929872721 2:45772370-45772392 GGGAGGTGGTAGAAGTAAGGAGG + Intronic
932488714 2:72104838-72104860 AGGTGCCAGTAAATGAAAGGGGG - Intergenic
934869965 2:97854689-97854711 GGGTGAGAGGAGAAGTAAGGGGG - Intronic
935131531 2:100264688-100264710 AGATGCTTGTGGAAGGAAGGAGG - Intergenic
935637937 2:105264335-105264357 AGGTGCTAGGAAAAGCAAGAAGG + Intergenic
938834562 2:135087184-135087206 AGGTGCTACTGGAATTCAGGGGG - Intronic
939159261 2:138566924-138566946 AGGAGTTAGCAGAAGTAAGAAGG + Intronic
941996263 2:171604687-171604709 AGGTGCTAACAGAGGCAAGGAGG + Intergenic
942291797 2:174480200-174480222 AGGTGCTATTTGAGGTAGGGTGG - Intronic
944591828 2:201225097-201225119 AGGTCCTAGAAGAAGCAAGATGG - Intronic
1170574273 20:17650585-17650607 ACGTGCTAGCAGAGGTAATGAGG + Intronic
1174201348 20:48808721-48808743 AGGTGGCAGTAGGAGTAGGGAGG - Intronic
1176904681 21:14484954-14484976 GGGTGATAGTAGCAGTAAAGAGG + Intergenic
1179474643 21:41635370-41635392 AGGTGTTATTAGAAGTAATTGGG + Intergenic
1179775655 21:43660120-43660142 AGGTGCTGGTCAAAGGAAGGCGG - Intronic
1180632741 22:17241088-17241110 AGGTGCAGGTAGGAGAAAGGGGG + Intergenic
1184579488 22:45404991-45405013 ATGTGCTAGTACAAGGGAGGGGG + Intronic
1184698309 22:46151442-46151464 TGGTGCCAGTGGAAGTCAGGAGG + Intronic
1184848835 22:47106676-47106698 AGGTGCAAGAAGAAATAATGAGG + Intronic
950313044 3:11975679-11975701 AGGTACTGGTAGCAGGAAGGTGG + Intergenic
951960521 3:28314008-28314030 AGGTGACAGTAAAGGTAAGGTGG + Intronic
953612743 3:44461148-44461170 AGCTGCTGGGAGAAGGAAGGAGG - Intronic
955544221 3:60010762-60010784 GTGTGCTAGGAGAAGAAAGGAGG - Intronic
956864686 3:73357245-73357267 AGGTATAAGTAGAAGTAGGGTGG - Intergenic
958967531 3:100575799-100575821 AGGGGCTAGTAGCAGGAAGTAGG + Intronic
960729315 3:120707877-120707899 ATGTGCTAGAAGAATCAAGGTGG + Intronic
965103827 3:164335290-164335312 AGGTACTTGTGGAAGTAAGTAGG + Intergenic
967130882 3:186469712-186469734 AGGTGCTCGGAGAAGGCAGGAGG - Intergenic
968802944 4:2755537-2755559 AGGTGCTGGTGGAGGTGAGGGGG - Intronic
974383892 4:61179759-61179781 AGTTGCTGTTAGAAGTAAGTAGG - Intergenic
975340292 4:73232229-73232251 AAGAGCTAGAAGAAGGAAGGTGG - Intronic
977522608 4:98103864-98103886 AGGTGATAATTGAAGTAATGAGG - Intronic
979021172 4:115500668-115500690 AGGTGTTAGTATAAGGGAGGAGG + Intergenic
979571509 4:122232054-122232076 AGGTGCGAATGGAACTAAGGAGG + Intronic
981062622 4:140441834-140441856 AGATGCTAGAAGAAAAAAGGGGG - Intergenic
981107967 4:140902971-140902993 TGGTGCTAGAAGGAGAAAGGTGG + Intronic
981382842 4:144093418-144093440 AGTTGCTAGTATAAGTAATAGGG + Intergenic
981548645 4:145919982-145920004 AGGTGCTTGTAGACTTCAGGTGG - Intronic
981978471 4:150761337-150761359 AGGTGATAGAGGAAATAAGGAGG - Intronic
990493130 5:56321306-56321328 AGGTGCTACTTGCAGTCAGGAGG + Intergenic
993741805 5:91550599-91550621 TGGTGAGAGTAGAAGCAAGGTGG + Intergenic
994459587 5:100054922-100054944 AGATGCGAGCAGAAGGAAGGAGG + Intergenic
996952377 5:129142911-129142933 AGGTGCTAGTAGATTTATAGAGG - Intergenic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997265488 5:132492354-132492376 AGGAGCTAGGAGAGGAAAGGAGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1000312240 5:160056201-160056223 AGGTGCTGGTGAAAGGAAGGTGG - Intronic
1001509747 5:172311722-172311744 AGGCACTAGTACAAGAAAGGAGG + Intergenic
1005738078 6:28767541-28767563 AGGTGCTTATGGAAGTAAGCAGG + Intergenic
1007042596 6:38737807-38737829 AGGTGCTAGAATAAGTATTGAGG + Exonic
1008089374 6:47277887-47277909 AGATGCTTGTAGGAGTAATGTGG - Intronic
1008141344 6:47835853-47835875 AGCTGCTATTAGAAGAAATGAGG + Intergenic
1009534935 6:64869898-64869920 AGGTAAGACTAGAAGTAAGGAGG + Intronic
1014783104 6:125587357-125587379 AGGAGCTCATAGAAGTAAGAAGG + Intergenic
1015092911 6:129380144-129380166 ATGTGCTAGAATAGGTAAGGAGG + Intronic
1020891484 7:13883415-13883437 AGGTGCTACTAGAAGCAGTGAGG - Intergenic
1022687295 7:32608805-32608827 AGGGGCTAGTGGAGGTGAGGAGG + Intergenic
1022953348 7:35359641-35359663 AGATGTTAGTGGAAGTAATGTGG + Intergenic
1024049739 7:45610902-45610924 AGGTGATAATGGAAGTATGGAGG + Intronic
1026166326 7:67912979-67913001 AGGTGCTGGTCGAAGTGAAGAGG + Intergenic
1027882093 7:83853381-83853403 AGGTGCAAATAGAAGTAAGTCGG + Intergenic
1028715909 7:93968081-93968103 AGGTGGTAGGAGTAGTATGGAGG - Intronic
1030776670 7:113542198-113542220 GGGTGCTAGAAAAAGTAAGATGG - Intergenic
1031027523 7:116696321-116696343 AAATGTTAGTAGAAGAAAGGGGG + Intronic
1031856690 7:126930931-126930953 AGGTGGAAGCAGAAGTGAGGGGG - Intronic
1040680602 8:49803848-49803870 AGGTGCTACTAGAAGAAGGTTGG + Intergenic
1041829968 8:62143258-62143280 AGGTGCAGGTAGGAGTCAGGAGG + Intergenic
1043719729 8:83532782-83532804 AGGTGGGAGTAGAAATAAAGAGG + Intergenic
1043922825 8:86003487-86003509 AGGTGCTAAGAGAATGAAGGTGG - Intronic
1047951459 8:129939346-129939368 AGGTGCCAATGGAAGGAAGGGGG + Intronic
1048236685 8:132697878-132697900 AGGTGCAATGAGAAGCAAGGAGG + Intronic
1050030749 9:1382655-1382677 AGGTGCTAGCAGAAGGTAAGGGG + Intergenic
1051295040 9:15586671-15586693 AATTGCTAGTGGAAGTCAGGAGG + Intronic
1051453730 9:17228568-17228590 AGGTGATGATAGAAGTAAGGTGG + Intronic
1055907749 9:81313852-81313874 AGGAACTAGTAGAAGGAAAGTGG - Intergenic
1185552124 X:990893-990915 AGGTCCTAACAGAAGAAAGGAGG - Intergenic
1186782757 X:12929860-12929882 AGGTCATAGTAGGAGTAGGGTGG - Intergenic
1187711991 X:22063523-22063545 AGGTGCTGGGTGAAGAAAGGAGG + Intronic
1187864899 X:23715126-23715148 AGGTGCTGGTGGAAGAAAGGAGG - Intronic
1188530272 X:31132716-31132738 AGGTGCTAGTAAAAGCAAGCAGG + Intronic
1192198640 X:69049245-69049267 AGGTGCTTGTAGAGTCAAGGGGG + Intergenic
1194349089 X:92803424-92803446 AGATGCTAGAAAATGTAAGGAGG - Intergenic
1195070357 X:101273229-101273251 AGGTGAGAGTAGAAGCAAAGAGG - Intronic
1196348489 X:114697731-114697753 AGGTACAAGAAGAAGTAATGAGG - Intronic
1196505703 X:116438735-116438757 AGGTTCTATTAGAAGTATAGAGG + Intronic
1197754551 X:129984428-129984450 AGGTGCTGGGAGAAGGAAGGGGG + Intronic