ID: 1086075032

View in Genome Browser
Species Human (GRCh38)
Location 11:82841495-82841517
Sequence ATTACATTTGAGCATGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086075032_1086075034 -1 Left 1086075032 11:82841495-82841517 CCTTTAACATGCTCAAATGTAAT 0: 1
1: 0
2: 2
3: 16
4: 271
Right 1086075034 11:82841517-82841539 TATGACTTTCCAAAGGAAGATGG 0: 1
1: 0
2: 0
3: 27
4: 283
1086075032_1086075033 -8 Left 1086075032 11:82841495-82841517 CCTTTAACATGCTCAAATGTAAT 0: 1
1: 0
2: 2
3: 16
4: 271
Right 1086075033 11:82841510-82841532 AATGTAATATGACTTTCCAAAGG 0: 1
1: 0
2: 4
3: 21
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086075032 Original CRISPR ATTACATTTGAGCATGTTAA AGG (reversed) Intronic