ID: 1086075032

View in Genome Browser
Species Human (GRCh38)
Location 11:82841495-82841517
Sequence ATTACATTTGAGCATGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086075032_1086075034 -1 Left 1086075032 11:82841495-82841517 CCTTTAACATGCTCAAATGTAAT 0: 1
1: 0
2: 2
3: 16
4: 271
Right 1086075034 11:82841517-82841539 TATGACTTTCCAAAGGAAGATGG 0: 1
1: 0
2: 0
3: 27
4: 283
1086075032_1086075033 -8 Left 1086075032 11:82841495-82841517 CCTTTAACATGCTCAAATGTAAT 0: 1
1: 0
2: 2
3: 16
4: 271
Right 1086075033 11:82841510-82841532 AATGTAATATGACTTTCCAAAGG 0: 1
1: 0
2: 4
3: 21
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086075032 Original CRISPR ATTACATTTGAGCATGTTAA AGG (reversed) Intronic
905163970 1:36065256-36065278 ATTACATTTCAACATGTCCAAGG + Exonic
908878359 1:68702987-68703009 TTTGCTTTTGAACATGTTAAGGG - Intergenic
909597265 1:77420728-77420750 ATTACTAGTGAGCTTGTTAATGG - Intronic
910266551 1:85344302-85344324 ATTACATTTGTGTATATTTATGG - Intronic
910426553 1:87124984-87125006 ATTTCCTTTGAGCATTTTGATGG + Intronic
911548103 1:99245363-99245385 ATAACATTTGAGTATGTTTTGGG + Intergenic
911972957 1:104460776-104460798 AATCCAGTTGAGCATGTAAATGG + Intergenic
912223810 1:107708392-107708414 TTTACTTTTGAGAATGTCAATGG + Intronic
913419456 1:118648987-118649009 ATGCCATTTGAACATGCTAAGGG - Intergenic
916162504 1:161932509-161932531 TTTACATTTAATCATTTTAATGG - Intronic
916507131 1:165438254-165438276 ATTTCCTTTGAGCATGATATTGG - Intronic
918281401 1:183009741-183009763 ATGACATTTGAACATTTTCATGG - Intergenic
920036535 1:203069179-203069201 ATTACATTTCATCATTTTTATGG + Intronic
920447886 1:206033706-206033728 ATTAGATATGAGCATGTTTTGGG + Intergenic
920618861 1:207524253-207524275 ATTACCTTTGAGTATAATAATGG + Intronic
921489759 1:215760714-215760736 ATTACATTTGGGCGTATGAAAGG - Intronic
921503073 1:215930669-215930691 ATTAGATTTAAGCAAATTAAGGG + Intronic
924248932 1:242111586-242111608 ATCAAATTTCAGTATGTTAATGG - Intronic
924461626 1:244264946-244264968 ATGGCATGTGAGCATGTGAAGGG + Intergenic
924600121 1:245481378-245481400 GTTACATTTGAGCACGGGAATGG - Intronic
1063711801 10:8486602-8486624 ATTTCATTTGTGCATGTTTCAGG + Intergenic
1065425595 10:25599508-25599530 TTTCCATTTCAGCATGTTTAAGG + Exonic
1065577060 10:27131860-27131882 GTCACCTTTGAACATGTTAAAGG - Exonic
1065910371 10:30298650-30298672 ATTACAAATGAGCATGTAATGGG - Intergenic
1066102419 10:32129593-32129615 TTCACATTTTAGCATGTGAATGG - Intergenic
1068709398 10:60117048-60117070 ATTTCCTGTCAGCATGTTAAAGG - Intronic
1069111870 10:64457388-64457410 ATTACTTTTGAATATGTTGATGG - Intergenic
1069315131 10:67089268-67089290 ATTACATTTAAGAATTATAAAGG + Intronic
1070035879 10:72723760-72723782 AGCACATTTGAGGATTTTAAAGG + Intronic
1070463627 10:76695091-76695113 ATTATATGTGAGCATATCAATGG + Intergenic
1074340235 10:112621274-112621296 ATTACACATTAGCATATTAATGG + Intronic
1074721566 10:116270387-116270409 CTTACATCAGAGCAGGTTAAAGG + Intronic
1075267838 10:121019943-121019965 ACAACATTTGAGTCTGTTAAGGG + Intergenic
1077932012 11:6743275-6743297 TTTACATCAAAGCATGTTAAGGG + Intergenic
1079324514 11:19480200-19480222 AGTACATATTAGCAGGTTAAGGG - Intronic
1082895681 11:58187693-58187715 ATTATATATTAGCATATTAAAGG - Intergenic
1083522476 11:63327953-63327975 AATACATATGAGCTTGTCAAGGG + Intronic
1085564995 11:77505691-77505713 ATGAAATTTGAGGATGTTACTGG - Intergenic
1086075032 11:82841495-82841517 ATTACATTTGAGCATGTTAAAGG - Intronic
1086105545 11:83143113-83143135 ATAACATTTGAGCATTTTCTAGG + Intergenic
1087029467 11:93688240-93688262 AGGATATATGAGCATGTTAATGG + Intronic
1088334754 11:108691076-108691098 ATTGCATTTGAGAAAGTGAATGG + Intronic
1088460261 11:110075253-110075275 ATTACAATTGAACATGATATTGG + Intergenic
1089382063 11:118040775-118040797 ATTACATTTGTATATGTTATAGG - Intergenic
1094004418 12:25733313-25733335 ATTACATTTGTATATGTTATAGG + Intergenic
1094096805 12:26714566-26714588 ATTTCATTTTAGAATATTAAAGG + Intronic
1094193490 12:27721132-27721154 ATTAAATTTGAGCTTTTGAAAGG + Intronic
1094636295 12:32229813-32229835 ATAACATTTGTGAATGCTAATGG + Intronic
1099366695 12:81773781-81773803 TTCACCTTTGATCATGTTAAGGG + Intergenic
1099714832 12:86277920-86277942 ATTTCATTTAAGCATGTCATTGG + Intronic
1099769883 12:87037777-87037799 ATTTCAATTAAGCATTTTAAAGG - Intergenic
1100130830 12:91491279-91491301 ATCACATTTAAGCATGGTACTGG - Intergenic
1102072265 12:110030677-110030699 ATTACATTTGGAAATGTTAATGG + Exonic
1104101273 12:125613975-125613997 ATTACATTTATTCATGTTATTGG + Intronic
1105590241 13:21785855-21785877 ATTATAATTCAGCATGTTGAGGG + Intergenic
1107497310 13:40939695-40939717 ATTTCCTTTGAGCATCTTATTGG - Intronic
1108280859 13:48860184-48860206 ATTTCATTTTAGAATGGTAAAGG + Intergenic
1109174779 13:59142004-59142026 ATCAAATTTGAGCATGGCAAAGG + Intergenic
1109445214 13:62429290-62429312 ATTACTTTCTAGCATTTTAAAGG + Intergenic
1111352880 13:87054674-87054696 ATTACGTTTAAGCAGTTTAACGG - Intergenic
1111671492 13:91336024-91336046 ATCCCATTTGATCATGTAAATGG + Intergenic
1112194135 13:97208168-97208190 ATTGCACATGAGCATATTAAAGG - Intergenic
1112468581 13:99667598-99667620 AGTACAATTGAACATTTTAAGGG + Intronic
1112926202 13:104678308-104678330 ATTACATTTTAGCCTGTGCAAGG - Intergenic
1114004356 14:18296112-18296134 ATTATATCTGAGCATGGCAAAGG - Intergenic
1114844306 14:26302467-26302489 ATAACTTTTGAGTATCTTAAGGG - Intergenic
1116313357 14:43354831-43354853 ATTACTTTTGATCATCTGAAGGG + Intergenic
1116987241 14:51234002-51234024 ATTACATTTCTGTATGTTATAGG - Intergenic
1118228765 14:63928164-63928186 GTTATATTTGAGAATGATAAAGG + Intronic
1119852823 14:77878340-77878362 ATTACATACGAGCATTTTGAAGG + Intronic
1120073789 14:80133233-80133255 ATTCAATGTGAACATGTTAAAGG + Intergenic
1124158692 15:27250314-27250336 CTTACATTTAATCAAGTTAAAGG + Intronic
1126667407 15:51087762-51087784 AATAAATTTGAGCCTGTTCATGG - Intronic
1126975227 15:54170610-54170632 ATTTCATTTGAACAGGTTAAAGG + Intronic
1130205081 15:81868340-81868362 GATACAATTGAGCATGTTTATGG - Intergenic
1130220967 15:82019215-82019237 ATTACCTTTGATCATTTTAAAGG - Intergenic
1130398301 15:83524396-83524418 ATAACATTTGTACATGTTTATGG + Intronic
1132040839 15:98523569-98523591 ATGGCATTTGAGCTTGGTAAAGG - Intergenic
1143672757 17:8407816-8407838 CTTATATTTGAGGCTGTTAAAGG - Intergenic
1145107174 17:20127971-20127993 ATTTCATTTTAGGATATTAAAGG - Intronic
1146274490 17:31508144-31508166 ATAACAAGTGAGCATGTCAAAGG - Intronic
1149710231 17:58735083-58735105 ATGACATTTTATAATGTTAAAGG + Exonic
1153883549 18:9442123-9442145 ATTACATTTTAGCATGTTTCAGG + Intergenic
1154352473 18:13596864-13596886 ATTACATTTCTACATGTTATTGG + Intronic
1155124779 18:22862224-22862246 AATATATTTTAGCATGTTAATGG - Intronic
1158256494 18:55555842-55555864 ATTTAATTTGAGCAAATTAATGG + Intronic
1159794811 18:72828998-72829020 CTTGCATTTGAGACTGTTAAGGG - Intronic
1160589078 18:79930636-79930658 ATTACATTTCTTTATGTTAAAGG - Intronic
1164028043 19:21371333-21371355 AAGACATTTGAGGATGTCAAGGG + Intronic
1165548216 19:36560392-36560414 ATTACATTTCTGTATGTTATGGG - Intronic
1168495126 19:56841010-56841032 TTTACATTTGAGCATCTCAGTGG - Intergenic
927819866 2:26254664-26254686 ATTAGGCTTGAGGATGTTAATGG + Intronic
929885816 2:45877136-45877158 ATTTCCTTTGAGCACCTTAAAGG + Intronic
930565721 2:53017895-53017917 ATGAAATCTGAGCAAGTTAAGGG - Intergenic
930583355 2:53240274-53240296 ATCACAATTGGGGATGTTAATGG - Intergenic
931623167 2:64231314-64231336 TTTAGTTTTGATCATGTTAAAGG + Intergenic
934783451 2:96987494-96987516 ATTACTGTTAAGCATGTTACGGG + Intronic
935929519 2:108108744-108108766 GTGACATTTGAACATGTTGAAGG + Intergenic
936503868 2:113088929-113088951 AGCAAATTTGAGCAGGTTAAAGG + Intergenic
937400285 2:121576644-121576666 ATTTCATTTGAGCATATTCTTGG - Intronic
939326380 2:140695126-140695148 ATTGAATTTGAGCATCCTAAAGG + Intronic
939442231 2:142264063-142264085 ATTACATTTCACCATGGAAACGG + Intergenic
940640991 2:156343771-156343793 CTTACATTCTAGGATGTTAAAGG + Intergenic
941182670 2:162279586-162279608 ATTACATTTGGCAATGATAATGG - Intronic
941583081 2:167324595-167324617 ATTAGATTTGAACATATTTATGG + Intergenic
942674854 2:178416084-178416106 CTTACATTTGTGCATCTTCAAGG + Intergenic
943193802 2:184717696-184717718 ATAATATTTGTGCATGTTTATGG + Intronic
943433448 2:187833227-187833249 ATAACAATTGAGCAAGATAAAGG - Intergenic
943756709 2:191564714-191564736 AGTAGATTTGAGTATGTTTATGG - Intergenic
944157497 2:196622612-196622634 ATTATATTTGGACATGGTAACGG + Intergenic
944726644 2:202477944-202477966 AATACATTTTAGCAAGTAAAAGG - Intronic
945157178 2:206851588-206851610 ATTACATTTCAACATTTTATTGG + Intergenic
945202715 2:207299241-207299263 ATTACTTTTCTGCATGTTATAGG - Intergenic
945645863 2:212492619-212492641 ATTAGATCTGATCATTTTAAAGG - Intronic
946137112 2:217656504-217656526 ATAATATTTGAGCATGTTTAGGG - Intronic
946918300 2:224549766-224549788 GCTACTTTTGGGCATGTTAAGGG - Intronic
1170287419 20:14725498-14725520 ACTATATATGAGCATGCTAAGGG - Intronic
1172369030 20:34372951-34372973 AATACATTCAATCATGTTAAAGG - Intronic
1172873799 20:38152160-38152182 ATTACATTAAAACATGTTCACGG + Intronic
1173160836 20:40651499-40651521 ATTACAGATTATCATGTTAATGG - Intergenic
1174332161 20:49829069-49829091 AATACATTTGAGGATGTTTTCGG + Intronic
1175442659 20:59002304-59002326 ATTGCATTTGTGCATGGGAAGGG - Intronic
1177842131 21:26246394-26246416 ATTCCCTTTTAGCATGTAAAAGG - Intergenic
1180428873 22:15226909-15226931 ATTATATCTGAGCATGGCAAAGG - Intergenic
1182867238 22:33614410-33614432 ATTACATTAGAGCAAGTGTATGG - Intronic
1182905376 22:33931354-33931376 ATTTCATTTGAGGCTTTTAAGGG - Intergenic
949116155 3:326902-326924 ATTATAATTTAGCATGTTAATGG - Intronic
949134756 3:550775-550797 AATACATTTGAGAAAGTTGATGG + Intergenic
950509451 3:13416980-13417002 ATTACATTTGCTCCTTTTAAAGG - Intronic
951654616 3:24991786-24991808 ATTACATTAAAGGAGGTTAAGGG - Intergenic
952070760 3:29633015-29633037 ATTACACTTGAGAATGTTCCAGG + Intronic
955815706 3:62840069-62840091 ATTAAATTTGATCATGTTCATGG + Intronic
956016282 3:64886915-64886937 ATTACAATTCAACATGTCAAGGG - Intergenic
957710696 3:83855308-83855330 ATTATATTTGATAATGTTTAAGG + Intergenic
958648956 3:96911492-96911514 GTTACATTTGAGCATGCCCATGG + Intronic
958752264 3:98205370-98205392 ATTTCATTTGAGCATATAAGTGG - Intergenic
959261421 3:104086417-104086439 AGTACATTAGAACATTTTAATGG + Intergenic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
959649367 3:108736620-108736642 ATTACATAAGAGAATGTAAAAGG - Intergenic
959802722 3:110514475-110514497 CTTACACTTGAGGATGTTCAAGG + Intergenic
960551459 3:118980789-118980811 ATTATATTTGTACATATTAATGG - Intronic
961495504 3:127288329-127288351 ATTAGATCTGAGCATGGTGAAGG + Intergenic
961974938 3:131013805-131013827 GTTCCATTTCAGCAAGTTAATGG - Intronic
963622530 3:147629493-147629515 CTTACATTTTAGCATTTTTAAGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964005072 3:151817263-151817285 ATTCCATTTGAGTTTATTAAGGG + Intronic
964204263 3:154154213-154154235 ATGACATTTTAAGATGTTAAAGG + Intronic
967510910 3:190311059-190311081 ATTACATTGGACCATGTTTTTGG - Intronic
967642365 3:191880793-191880815 TTTACATTTGAGCAGGTTTTAGG + Intergenic
969061697 4:4440609-4440631 AATGTATTTGAGCATATTAAAGG - Intronic
970400337 4:15711278-15711300 ATTACATTTTACAATGTTTAAGG - Intronic
970511426 4:16785490-16785512 ATTACATTTTGGCCTGTTTACGG - Intronic
971332149 4:25690774-25690796 ATGACATTTTAGCATCTGAATGG + Intergenic
972223008 4:36977719-36977741 CTTACATGTTAGCATGTTTAGGG - Intergenic
972370326 4:38417242-38417264 ATTACATTTCAGCATGAGATTGG + Intergenic
972780180 4:42280247-42280269 ATAACATTTTAGCATCTTAGGGG + Intergenic
973086267 4:46065231-46065253 TTTATATTTTAGCATGTGAAAGG + Intronic
973966086 4:56163434-56163456 ATTTCCTTTGAGATTGTTAAAGG - Intergenic
974135245 4:57808310-57808332 ATTACATTTAAATATATTAATGG + Intergenic
974247408 4:59337982-59338004 AATACCTTTGAGCAGGATAAAGG - Intergenic
974634761 4:64546516-64546538 AATACATTTGAGGATTTGAACGG + Intergenic
974726397 4:65804671-65804693 ATCACATTTGAGCATGTGGGGGG - Intergenic
977952652 4:102991921-102991943 ATTACATTTCTGTATGATAATGG - Intronic
977962589 4:103102931-103102953 ATTAGATTTGAAAATGCTAAAGG + Intergenic
979081314 4:116347225-116347247 ATTACATTTCAGCTTTTAAAGGG + Intergenic
979325011 4:119368880-119368902 ATTACAGTTTAGCATGTTAATGG + Intergenic
980171912 4:129299575-129299597 CTTACATATGAGCAGGTTAAAGG + Intergenic
980347873 4:131646581-131646603 TTTACTTTTGTGCATGTTATAGG - Intergenic
980775582 4:137431773-137431795 ATTACATTTTAACATGATATTGG - Intergenic
981214978 4:142153901-142153923 AGAACATTTGTGCATTTTAATGG + Intronic
981269317 4:142826054-142826076 ATTACATTTGAGCCTATCAATGG - Intronic
981798889 4:148633259-148633281 ATACCATTTGATCATGATAAAGG - Intergenic
983242916 4:165253898-165253920 ATTACAGTTTAGCATGTTAATGG + Intronic
983335234 4:166383689-166383711 ATTGCCTTTAACCATGTTAATGG - Intergenic
983903463 4:173161354-173161376 AAGAAATTTGAGCATTTTAAAGG + Intergenic
984296975 4:177864851-177864873 ATTACATTTGACCATGTAGGTGG - Intronic
985359131 4:189153840-189153862 ATTACATTTAAAAATTTTAAAGG + Intergenic
985371637 4:189291541-189291563 ATGACTTTGGAGCAGGTTAATGG + Intergenic
985383744 4:189423475-189423497 ATTACATTTGACCATATTACAGG + Intergenic
986188163 5:5464628-5464650 ATTCCCTTTGAGGATGTTGAGGG - Exonic
986327277 5:6685633-6685655 CTTAAAGTTGAGCATGTTAGAGG + Intergenic
987854821 5:23407224-23407246 ATTACATTTTAGCTTTTTAGTGG + Intergenic
988937474 5:36100878-36100900 AGTATATTTTAGCATATTAATGG - Exonic
989198368 5:38738095-38738117 AGTACATTTTTGCATGTGAAAGG + Intergenic
989723985 5:44565616-44565638 ATTACATTTCAGTCTTTTAATGG + Intergenic
990103569 5:52225818-52225840 ATTACATGTGAGAATGTAACTGG - Intergenic
990568320 5:57052519-57052541 AATTCATTTGTGCATATTAAAGG + Intergenic
991691506 5:69229996-69230018 ATTAAGTTTGAGAAGGTTAATGG - Exonic
991969840 5:72129158-72129180 ATTACATATGTACATGTAAATGG - Intronic
992143409 5:73821385-73821407 ATTACTTTTGAGGATATTTAGGG + Intronic
992165783 5:74049805-74049827 TTTACATTTGAGGAAATTAAAGG - Intergenic
992547668 5:77830682-77830704 AATTAATTTCAGCATGTTAAAGG + Intronic
992991689 5:82290236-82290258 TTTACATTTCTGCATGTTACTGG + Intronic
993016247 5:82538039-82538061 ATTACGTGTGAGAATGTTAGAGG - Intergenic
993355411 5:86900693-86900715 ATTAGCTTTGATCCTGTTAAAGG - Intergenic
993757939 5:91754492-91754514 AATACATTTTAGCATATTTATGG - Intergenic
994099176 5:95875982-95876004 AGAACATTTCAGCATATTAAAGG + Intergenic
994575355 5:101571067-101571089 TTTACTTCTCAGCATGTTAATGG - Intergenic
994756579 5:103800385-103800407 ATTACATTTGTGTATGTGTAGGG + Intergenic
995150095 5:108833500-108833522 TTTACATTGGATCATTTTAAAGG + Intronic
996886456 5:128360910-128360932 ATTGGATTTGAGAATGTTATGGG + Intronic
998299969 5:141008608-141008630 ATTATACTTGAGAAAGTTAATGG - Intronic
998477796 5:142436132-142436154 GTTTCATTAGAGCTTGTTAAAGG - Intergenic
998606575 5:143641550-143641572 ATTACATTTGCACATGCTGATGG - Intergenic
1000538574 5:162510443-162510465 ATTACAGATTAGCATGATAAAGG + Intergenic
1000593993 5:163193149-163193171 AATACATTTGGGCACTTTAAAGG - Intergenic
1000776410 5:165425463-165425485 ATCACATTTGAGGAAATTAAAGG - Intergenic
1000854558 5:166382024-166382046 ATTTCTTTTGAGCAGGATAATGG + Intergenic
1003781824 6:9437069-9437091 AACACATTTTAGCATGTCAAAGG + Intergenic
1004143331 6:13042109-13042131 ATTACAATTTAGCCTTTTAATGG - Intronic
1005065072 6:21810023-21810045 TTTACATTTGAAAATGTAAAAGG + Intergenic
1006279598 6:33039381-33039403 ATTATATTTGAACATATTCATGG + Intergenic
1006968508 6:38014898-38014920 ATCACTTTTAAGCATCTTAATGG - Intronic
1007280309 6:40707446-40707468 AGGACAGATGAGCATGTTAAAGG + Intergenic
1007817700 6:44536213-44536235 AATACCTTTTAGCATATTAAAGG - Intergenic
1008257552 6:49322495-49322517 ATTATATTTGAGCATATTAGAGG - Intergenic
1008299236 6:49814136-49814158 ATTACATTTGATCATGAGACAGG + Intergenic
1008301522 6:49846608-49846630 ATTACACTTGACCATGATACAGG + Exonic
1008824221 6:55672479-55672501 ATTATATTTGATTATTTTAAAGG - Intergenic
1009794076 6:68443490-68443512 ATTAAATTTTAGCATGGTTATGG - Intergenic
1011565769 6:88669934-88669956 AATCCAGTTGAGCATGTAAATGG - Intronic
1013441583 6:110176469-110176491 ATTATATCTGAGCAGGTAAATGG + Intronic
1013810817 6:114042308-114042330 ATTACATCTGTGCCTTTTAAAGG - Intergenic
1015078094 6:129187785-129187807 ATTCCATTTGAGCATCATATAGG + Intronic
1015155268 6:130087608-130087630 CTTTCATTTAAGAATGTTAAGGG + Intronic
1015902923 6:138085872-138085894 AATTCATTTCAGCATATTAATGG + Intergenic
1018607813 6:165617105-165617127 TTTCCATTTAAGGATGTTAAAGG - Intronic
1018891044 6:167982551-167982573 ATTACATTTCTACATGTTACAGG - Intergenic
1019091456 6:169538488-169538510 ATTTCATTTTAGCTTGTGAAAGG - Intronic
1019317507 7:395396-395418 ATTACATTTCTACATGTTATAGG + Intergenic
1021544896 7:21802498-21802520 ATTGCATATGAGCTTTTTAATGG - Intronic
1021616172 7:22505385-22505407 AATTCGTTTTAGCATGTTAAAGG + Intronic
1022361086 7:29658432-29658454 ATGACATCTGAACATTTTAAAGG + Intergenic
1022405900 7:30089600-30089622 CTTACATTTGCTCATGTTTAAGG - Intronic
1022925964 7:35056600-35056622 AATTCGTTTTAGCATGTTAAAGG + Intergenic
1022936171 7:35180429-35180451 ATGACATTTGAACATTTTAAAGG - Intergenic
1023689270 7:42769507-42769529 ATTATATTTGAGTCTGTTAAAGG - Intergenic
1023709998 7:42981926-42981948 ATTGCATTTGGGGATTTTAATGG + Intergenic
1023732041 7:43201375-43201397 ATTACCTCTGTGCATGTTCATGG + Intronic
1024159512 7:46659888-46659910 ATTAGATTTAATGATGTTAATGG - Intergenic
1024678377 7:51658655-51658677 AATACACTTGAGCAAGTCAAAGG + Intergenic
1027435172 7:78156728-78156750 ATTACATTTAAGCAAGAAAAGGG - Intronic
1027750130 7:82133152-82133174 ATTGCATTTGGCCATGTTTAAGG - Intronic
1028045655 7:86115807-86115829 TTTAAATTTGAGAATCTTAATGG + Intergenic
1028376297 7:90148953-90148975 AATTCGTTTTAGCATGTTAAAGG - Intergenic
1028561148 7:92178013-92178035 TTTCCATATGAGCATTTTAAAGG + Intronic
1029806829 7:103006557-103006579 TTTATATTTAAGCATTTTAAGGG - Intronic
1029823973 7:103171289-103171311 AATTCGTTTTAGCATGTTAAAGG + Intergenic
1029832138 7:103273141-103273163 ATGACATTTGAACATTTTAAAGG - Intergenic
1030117724 7:106074858-106074880 AGTAGATGTGAGCATGTTAGTGG - Intergenic
1030471381 7:109966734-109966756 AAGACATATGAGCATGTTAGAGG + Intergenic
1030805074 7:113907288-113907310 TTTACATTTCAGCATATTAAGGG + Intronic
1031403261 7:121351669-121351691 ATTACATTTGACCAGAATAAAGG + Intronic
1034716301 7:153245711-153245733 ATGACATATTAGCTTGTTAAAGG - Intergenic
1035827369 8:2659334-2659356 ATTACATTAGAGGATTCTAATGG - Intergenic
1036039183 8:5056028-5056050 ATTACTTTTAAGCAGATTAATGG + Intergenic
1036439805 8:8772026-8772048 ATTACATTTCTGTATGTTACAGG + Intergenic
1037953633 8:23036259-23036281 ATTACATTTGAAAATGGAAATGG - Intronic
1039164133 8:34657663-34657685 ATTAGATTTGAGCATATTTGGGG + Intergenic
1039208604 8:35185405-35185427 ATTGGGTTTGTGCATGTTAATGG - Intergenic
1039240274 8:35548587-35548609 ATTACATTTGATCAAATGAAAGG - Intronic
1039982560 8:42420222-42420244 ATTAGATTTTAGTATGTAAATGG - Intronic
1040740384 8:50567728-50567750 ATTACAATTGTACATTTTAATGG + Intronic
1041054526 8:53969750-53969772 ATTATAGATGAGGATGTTAAGGG - Intronic
1042294044 8:67200943-67200965 AATACATTTTAGAATTTTAAGGG - Intronic
1042330773 8:67578360-67578382 GTTACATTTGAGCACTTTGAGGG - Intronic
1043304532 8:78778058-78778080 ATTACAGTTGAAAATGTTTAGGG - Intronic
1043691441 8:83158372-83158394 ATTGCAAGTGAACATGTTAAGGG - Intergenic
1043819762 8:84847793-84847815 ACTCCATTTGAGCATCTGAATGG - Intronic
1045074795 8:98552380-98552402 ATCACATTTGGACATGATAAAGG - Intronic
1046986602 8:120395342-120395364 ACTGCATTTGAGCATTTTCATGG - Intronic
1047801159 8:128311798-128311820 ATTACAATTCAGTATGCTAAAGG + Intergenic
1048219628 8:132529412-132529434 ATTACGTATGTGCATGTGAAAGG + Intergenic
1050796659 9:9554277-9554299 ATGAGATTTGAGCATTTTATGGG + Intronic
1050831752 9:10022542-10022564 ATTACATTTCAGCAAGTAACTGG + Intronic
1052017443 9:23485502-23485524 ATTATCTTTGAAAATGTTAAAGG - Intergenic
1052727915 9:32251907-32251929 ATTTCATGTGAGCAAGTGAAAGG + Intergenic
1058503008 9:105640668-105640690 ATTATATAGGAGCTTGTTAATGG - Exonic
1059795420 9:117689960-117689982 ATTACATTTCTGCATATTATAGG - Intergenic
1059882737 9:118709733-118709755 ATAACATTTGAGCAGGGTCACGG - Intergenic
1061956480 9:133964615-133964637 ATCCCATTTGATCATGGTAAGGG - Intronic
1062403927 9:136384780-136384802 ATTACATTTCAGCTTGAAAAAGG - Exonic
1185798968 X:2992151-2992173 ATTACATTTCTCCACGTTAAAGG + Intergenic
1185823081 X:3223491-3223513 ATTACATTTCAAGATGTAAAAGG + Intergenic
1188366420 X:29320825-29320847 AATATATTTGAGCATATTTAGGG + Intronic
1188412188 X:29886610-29886632 ATGACAATTGAATATGTTAAAGG + Intronic
1195990570 X:110678339-110678361 CTTACATTTGAACATTTTACTGG + Intronic
1196056965 X:111366371-111366393 ATTACTTTTTACCGTGTTAATGG - Intronic
1199058481 X:143326113-143326135 AATACATTTCTACATGTTAAGGG - Intergenic
1199169978 X:144724077-144724099 ATCACATTTTATCATTTTAATGG + Intergenic