ID: 1086075032 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:82841495-82841517 |
| Sequence | ATTACATTTGAGCATGTTAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 290 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 16, 4: 271} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1086075032_1086075034 | -1 | Left | 1086075032 | 11:82841495-82841517 | CCTTTAACATGCTCAAATGTAAT | 0: 1 1: 0 2: 2 3: 16 4: 271 |
||
| Right | 1086075034 | 11:82841517-82841539 | TATGACTTTCCAAAGGAAGATGG | 0: 1 1: 0 2: 0 3: 27 4: 283 |
||||
| 1086075032_1086075033 | -8 | Left | 1086075032 | 11:82841495-82841517 | CCTTTAACATGCTCAAATGTAAT | 0: 1 1: 0 2: 2 3: 16 4: 271 |
||
| Right | 1086075033 | 11:82841510-82841532 | AATGTAATATGACTTTCCAAAGG | 0: 1 1: 0 2: 4 3: 21 4: 370 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1086075032 | Original CRISPR | ATTACATTTGAGCATGTTAA AGG (reversed) | Intronic | ||