ID: 1086075776

View in Genome Browser
Species Human (GRCh38)
Location 11:82850341-82850363
Sequence ATATTTCATCCTAAACCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086075773_1086075776 -6 Left 1086075773 11:82850324-82850346 CCAACTACCATATGAGGATATTT 0: 1
1: 1
2: 1
3: 17
4: 209
Right 1086075776 11:82850341-82850363 ATATTTCATCCTAAACCAGGCGG 0: 1
1: 0
2: 0
3: 11
4: 126
1086075770_1086075776 13 Left 1086075770 11:82850305-82850327 CCAGTACAAATGCACTTACCCAA 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1086075776 11:82850341-82850363 ATATTTCATCCTAAACCAGGCGG 0: 1
1: 0
2: 0
3: 11
4: 126
1086075772_1086075776 -5 Left 1086075772 11:82850323-82850345 CCCAACTACCATATGAGGATATT 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1086075776 11:82850341-82850363 ATATTTCATCCTAAACCAGGCGG 0: 1
1: 0
2: 0
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086075776 Original CRISPR ATATTTCATCCTAAACCAGG CGG Exonic
901046210 1:6397364-6397386 CTATTTCATTCTAAACCACTTGG - Intergenic
901809495 1:11759337-11759359 ATCTTTCCTCCTAAATCTGGTGG - Intergenic
906134928 1:43492034-43492056 ACATTTCTTCCTACCCCAGGAGG + Intergenic
910211379 1:84797266-84797288 ATAAATCATCATAAACCAGGTGG + Intergenic
911365010 1:96927624-96927646 ATATTTCATATTAATCAAGGAGG + Intergenic
912749768 1:112276876-112276898 ATATTACAGCCTGAACCAGTTGG - Intergenic
915182717 1:154077027-154077049 ATCTTTCATCAGAAACCATGAGG + Intronic
917301467 1:173578955-173578977 ACAATTCAACCTAAAACAGGAGG + Intronic
919050704 1:192507790-192507812 CTATTTCATCCTCAACCCAGTGG + Intergenic
919086255 1:192924251-192924273 AGATATCATCCTACACCAGTTGG + Intergenic
1063159210 10:3407656-3407678 ACAATTCATCTTAAAGCAGGTGG - Intergenic
1064248919 10:13692014-13692036 ATATTTCATCCAAAAAAATGGGG - Intronic
1064614713 10:17141075-17141097 ATGTCTCATCCAAAACCATGAGG - Intergenic
1065676557 10:28181359-28181381 AAACTTCATTTTAAACCAGGTGG + Intronic
1067886883 10:50097853-50097875 ATAATTCATCCTGAACCCAGAGG + Intronic
1070416577 10:76195862-76195884 ATATTTTATCCTAAAAGAAGTGG - Intronic
1073142548 10:101258446-101258468 AAATGTAGTCCTAAACCAGGTGG + Intergenic
1075591734 10:123696514-123696536 ATATTGAATGCTAAACCAGCTGG - Intergenic
1079476670 11:20837907-20837929 ATATTCCATCCTCAAGGAGGTGG + Intronic
1084346238 11:68551431-68551453 GTATTTCATGCTGAACCAGCTGG + Intronic
1086075776 11:82850341-82850363 ATATTTCATCCTAAACCAGGCGG + Exonic
1087391965 11:97546611-97546633 ATATTTCATGCTCAAGAAGGTGG + Intergenic
1087535776 11:99443240-99443262 TTCTTTGATCCTAAAACAGGTGG + Intronic
1089685151 11:120141953-120141975 ATGTTTCTCCCTATACCAGGTGG + Intronic
1089957720 11:122587467-122587489 ATTTTTCATCAGAAACCATGGGG - Intergenic
1092919374 12:13217372-13217394 CTATTTCATCCAAGACCAGAAGG - Exonic
1093227013 12:16497091-16497113 ATATTTAATCCTATGCCAGAAGG + Intronic
1093677084 12:21955725-21955747 ATATTTCAAGCTAAACAATGTGG + Intergenic
1094058534 12:26289724-26289746 AGGTTTCATTCTAAACCATGGGG + Intronic
1094532980 12:31295150-31295172 ATATTACTTCCTAAATTAGGGGG + Intronic
1098945689 12:76587166-76587188 ACATTTCACCCTATACCAGGTGG - Intergenic
1100724708 12:97396390-97396412 ATATTTCACCATAAAACAGCAGG + Intergenic
1102317324 12:111899773-111899795 ATTTTTCCTCCTTAATCAGGAGG - Intergenic
1108132921 13:47322744-47322766 ATAATTCTTCCTTATCCAGGAGG - Intergenic
1109672824 13:65632479-65632501 ATATTTCATCCTGAACCACCTGG - Intergenic
1110415719 13:75249887-75249909 ATATTTTATAGTAAAGCAGGTGG + Intergenic
1111660380 13:91202599-91202621 ATATTTGATCCTGAACCATTTGG - Intergenic
1115068177 14:29291229-29291251 ATATTTCATTCTCAAGTAGGTGG + Intergenic
1118237884 14:64026804-64026826 ATATTATATCCAAACCCAGGGGG - Intronic
1120037715 14:79716822-79716844 GAATTTAATCCTAAAGCAGGAGG - Intronic
1120261944 14:82196952-82196974 AGATTTCCTCTTAAACAAGGAGG - Intergenic
1122426885 14:101615064-101615086 ATATTTCACCCTCAAGGAGGAGG + Intergenic
1126548890 15:49905400-49905422 ATATTTCATCCCAAAGCTGTAGG + Intronic
1126926428 15:53592638-53592660 AAATTTCATGCTAAACCATGTGG - Intronic
1131357031 15:91754322-91754344 TTATTTCATCCTCAACAGGGAGG - Intergenic
1131658555 15:94488046-94488068 TAATTTCATCCTTAACCAAGTGG - Intergenic
1131792813 15:95983480-95983502 ATATTTCTTCGTAACCCTGGTGG - Intergenic
1134802942 16:17102024-17102046 ATACTTCTGCCTCAACCAGGAGG + Exonic
1144754983 17:17674325-17674347 AAATTTCATCATAAATCAGCCGG + Intergenic
1157991990 18:52508121-52508143 TTATTTCATCCTAATCTACGGGG + Intronic
1162374059 19:10294748-10294770 GAATTCCAGCCTAAACCAGGGGG + Intronic
928150150 2:28819900-28819922 ATATTTTATCCTGAGGCAGGAGG + Intronic
932118239 2:69073447-69073469 ATATTTTCTACTAAAACAGGAGG + Intronic
933557291 2:83847008-83847030 ATATTTCATCCTGAATCAAAGGG - Intergenic
936085316 2:109463546-109463568 ATATTTCCTCCCACCCCAGGAGG - Intronic
937869964 2:126779675-126779697 ATATTTCATCCTTAAAAAAGAGG - Intergenic
939156902 2:138536603-138536625 AAATTTCTTCCGAATCCAGGTGG + Intronic
940097053 2:149988962-149988984 ATATTTGATCCTGAATGAGGAGG - Intergenic
941730393 2:168911073-168911095 ATATTTCATTATAAAACAGATGG + Intronic
942184927 2:173415989-173416011 ATCTTTCATCCTAACAAAGGTGG + Intergenic
942280096 2:174353268-174353290 ATATTTCATTTTAAACCAAGAGG + Intronic
942412372 2:175723932-175723954 TTATTTCTTCCTTGACCAGGGGG - Intergenic
943024831 2:182615274-182615296 ATATGCCATCATATACCAGGAGG - Intergenic
945101523 2:206266790-206266812 ATTTTTCAACCTAAAACTGGGGG - Intergenic
945718006 2:213382277-213382299 ATTGCTCATCATAAACCAGGAGG - Intronic
946379569 2:219336530-219336552 ATTTTTCATTATAAACCATGTGG + Intergenic
947264624 2:228263514-228263536 CTATTTCATCCTAAAAGAGGTGG - Intergenic
1169033081 20:2428202-2428224 ATATTTCATCCAACAACAGCAGG - Intronic
1175815205 20:61879924-61879946 AAATTTCTTCCCAAACAAGGGGG + Intronic
1177773450 21:25543003-25543025 GTATTTGATACTAAACCAGCAGG - Intergenic
1180686642 22:17672690-17672712 ATACTTCATAATAAACCATGTGG - Intronic
1180716520 22:17876298-17876320 ATAGTTCATTCTGAACCTGGTGG - Intronic
1184575229 22:45358565-45358587 ATATTTCTTCCAAAACCATTAGG + Intronic
949148320 3:731931-731953 ATATTTCTTCCTAAAGAAGTAGG + Intergenic
951092277 3:18588048-18588070 ATAATTCAACCTATAGCAGGAGG + Intergenic
955513241 3:59701808-59701830 AAATTTCCTCCTAAACCATTAGG - Intergenic
955681693 3:61508006-61508028 ATTTTTCATCTGAAACCAAGGGG - Intergenic
956822697 3:72968259-72968281 AAATTTCCTCCTAAAGTAGGTGG - Intronic
957471242 3:80659595-80659617 ATTTCTCATCTAAAACCAGGAGG + Intergenic
957679511 3:83415159-83415181 GTATTTCATCCATAACCAGATGG + Intergenic
957782180 3:84833990-84834012 AAAATTCAGTCTAAACCAGGTGG - Intergenic
958161897 3:89827909-89827931 ATATTTCACCCTAAACAATCAGG - Intergenic
960179213 3:114554925-114554947 ATATTTCAACATAAACTATGAGG - Intronic
965276266 3:166686590-166686612 ATATCACATCCTAAAATAGGTGG - Intergenic
972590434 4:40480993-40481015 ATATTTCCTCCTGAGCCAGGAGG + Intronic
973228490 4:47814450-47814472 ATTTTTCATCTTAAATGAGGGGG - Intronic
974922266 4:68256399-68256421 TTCTTTCATCCTAAACCTGAAGG - Intergenic
975878420 4:78871439-78871461 ATCTATCAACCAAAACCAGGAGG - Intronic
980540984 4:134194649-134194671 ATATTTTTTCATAAACCAGTTGG + Intergenic
980792659 4:137639013-137639035 TTATTTCTTCCTAGGCCAGGAGG - Intergenic
981050055 4:140300802-140300824 ATATTTCATCTGAAACCACCAGG - Intronic
981492878 4:145359277-145359299 ATACTTCATCCTAATATAGGGGG + Intergenic
982604669 4:157499306-157499328 ATATTTCATACTAAAACAAATGG - Intergenic
982890569 4:160844271-160844293 ATAATTCATCCTGAAGCAGCTGG - Intergenic
983822290 4:172210771-172210793 ATATTCCACCCTCAACTAGGTGG - Intronic
984026954 4:174554419-174554441 TTATTTCATCCCAGACCTGGGGG + Intergenic
985766529 5:1782555-1782577 ATATTTTATTCTGAACCAGTGGG - Intergenic
988171630 5:27664551-27664573 ATTTTTCATCATACACCAAGAGG - Intergenic
988328892 5:29808880-29808902 ATACTTCATCCTCAAGGAGGTGG - Intergenic
990043328 5:51398645-51398667 ATCTTTCTTCCAAATCCAGGTGG - Intergenic
1000086771 5:157894526-157894548 ATATTTCAAACTAATCCAGTAGG - Intergenic
1003232876 6:4270629-4270651 ATATTACAAAATAAACCAGGTGG + Intergenic
1004537194 6:16514571-16514593 AGATTTGATCCTAAACCTTGGGG + Intronic
1005826990 6:29638565-29638587 GTCTTTCATCCTAACCCAAGAGG - Intergenic
1008055399 6:46940501-46940523 ATATTTCAGCCTTAGCCAGTTGG + Intronic
1008323252 6:50144292-50144314 ATATTTCATCATAAAACATGAGG - Intergenic
1008888274 6:56455062-56455084 ACATTTCATCTTAAAAGAGGAGG + Intergenic
1009755610 6:67936159-67936181 ATAGTTCATTGTAAACCATGGGG - Intergenic
1010843559 6:80677728-80677750 ATATTTCATCCAAATCTAGGAGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015047349 6:128791856-128791878 ATATTTCCTCCTTATCCATGAGG + Intergenic
1015346481 6:132165243-132165265 ATATATCAGCCTATGCCAGGGGG + Intergenic
1021788296 7:24174574-24174596 ACATTTAAGCCTAAATCAGGTGG - Intergenic
1022667525 7:32426083-32426105 ATGTTTCATCCTATATTAGGTGG + Intergenic
1025107940 7:56188246-56188268 AAATTCCATCCTAAAACATGTGG - Intergenic
1028528291 7:91809680-91809702 ATGTTGCATTCTAAAGCAGGAGG - Intronic
1028571887 7:92298419-92298441 ATATTTTAACATAAACCAAGTGG + Intronic
1034761830 7:153679715-153679737 AGATTTCATCCTAACCCTGGAGG + Intergenic
1036210776 8:6839415-6839437 ATATTTCAACAAAAACGAGGAGG + Intergenic
1038033565 8:23665949-23665971 ATATTCCATCCTCAACGAAGAGG - Intergenic
1040350550 8:46562422-46562444 ATATTTCATTGTAAAAAAGGTGG + Intergenic
1040887988 8:52285914-52285936 ACACTTCACCCTAAACCATGTGG + Intronic
1041212867 8:55570129-55570151 ATATTTCTTCCTAAGCCACCTGG + Intergenic
1045564593 8:103299793-103299815 ATATTCCATGCTAAGGCAGGTGG + Intronic
1048765095 8:137835026-137835048 ACATTTCACCAGAAACCAGGGGG - Intergenic
1048843548 8:138585365-138585387 ATATTTCAACCCAAACCTTGGGG - Intergenic
1051817341 9:21123528-21123550 TAATTTTATCCTAAACCATGTGG + Intergenic
1051968382 9:22857667-22857689 CTATTTCAACCTAAACAAGTAGG + Intergenic
1052405669 9:28057209-28057231 ATATTTCAGCCCAAATCAGTTGG - Intronic
1058281206 9:103117021-103117043 ATTTCTCATCATAAACCAGAGGG + Intergenic
1060260677 9:122071244-122071266 ATATTTCAGCCTCACCGAGGAGG - Intronic
1186139624 X:6557734-6557756 ATATTTCATCTTAGACAATGTGG + Intergenic
1186367690 X:8912669-8912691 GTATTTCATCCTAAACAATATGG - Intergenic
1187799953 X:23050529-23050551 ATATATTAGCCTAAACCAGTGGG + Intergenic
1190469244 X:50760964-50760986 CTATTTCATACAAAACAAGGCGG - Intronic
1197948502 X:131867897-131867919 ATATTTCATCCAACAACAGGAGG - Intergenic
1198249639 X:134867606-134867628 AAGTTTCTTCCTAAACCAGCGGG + Intergenic
1198778291 X:140205251-140205273 ATATTTCACCCTAAATGAAGTGG - Intergenic