ID: 1086075950

View in Genome Browser
Species Human (GRCh38)
Location 11:82852400-82852422
Sequence ATGTATACACTGATGGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086075942_1086075950 29 Left 1086075942 11:82852348-82852370 CCTAGTAAAGGACTGGCCCCAAG 0: 1
1: 0
2: 2
3: 11
4: 104
Right 1086075950 11:82852400-82852422 ATGTATACACTGATGGTATTAGG 0: 1
1: 0
2: 2
3: 19
4: 252
1086075946_1086075950 5 Left 1086075946 11:82852372-82852394 CCTTCTAGCTGAGAGTTCCCAAA 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1086075950 11:82852400-82852422 ATGTATACACTGATGGTATTAGG 0: 1
1: 0
2: 2
3: 19
4: 252
1086075944_1086075950 12 Left 1086075944 11:82852365-82852387 CCCAAGTCCTTCTAGCTGAGAGT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1086075950 11:82852400-82852422 ATGTATACACTGATGGTATTAGG 0: 1
1: 0
2: 2
3: 19
4: 252
1086075943_1086075950 13 Left 1086075943 11:82852364-82852386 CCCCAAGTCCTTCTAGCTGAGAG 0: 1
1: 0
2: 0
3: 9
4: 191
Right 1086075950 11:82852400-82852422 ATGTATACACTGATGGTATTAGG 0: 1
1: 0
2: 2
3: 19
4: 252
1086075945_1086075950 11 Left 1086075945 11:82852366-82852388 CCAAGTCCTTCTAGCTGAGAGTT 0: 1
1: 0
2: 0
3: 4
4: 124
Right 1086075950 11:82852400-82852422 ATGTATACACTGATGGTATTAGG 0: 1
1: 0
2: 2
3: 19
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086075950 Original CRISPR ATGTATACACTGATGGTATT AGG Intronic
904668780 1:32146063-32146085 ATGTATATTCTGCTGTTATTGGG + Intronic
906159007 1:43633809-43633831 ATGCTGACACTGATGGTCTTTGG - Intergenic
907052615 1:51339913-51339935 ATGTCTAAGGTGATGGTATTAGG + Intronic
909235264 1:73144896-73144918 ATATATACTTTGATGGTCTTAGG - Intergenic
909715217 1:78699541-78699563 ATGTATACTCTGTTGTTTTTGGG + Intergenic
910656120 1:89620396-89620418 ATTTAAAGACTGATGGAATTTGG + Intergenic
911094555 1:94044892-94044914 ATGTATACACTGGTGCTAAGGGG - Intronic
911835422 1:102612745-102612767 ATGTATATTCTGTTGGTTTTGGG - Intergenic
911877497 1:103186935-103186957 ATGTATATTCTGTTGGTTTTGGG - Intergenic
912186640 1:107284430-107284452 ATATATGCAATAATGGTATTTGG + Intronic
912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG + Intergenic
912310910 1:108620517-108620539 GTGTATACTCTGCTGGCATTTGG + Intronic
914949119 1:152095804-152095826 ATGTAAACACTGGTGATATATGG - Intergenic
916901372 1:169227744-169227766 GTGTATATGTTGATGGTATTTGG - Intronic
917524636 1:175776440-175776462 ATGTATATACTGTTGTTTTTGGG - Intergenic
917610383 1:176683408-176683430 ATGTACAAGTTGATGGTATTGGG + Intronic
918975786 1:191484113-191484135 TTGTATAAATTTATGGTATTTGG + Intergenic
919355733 1:196518968-196518990 ATGTATACTCTGTTGTTTTTGGG - Intronic
919686207 1:200485934-200485956 ATGTACAGTTTGATGGTATTTGG - Intergenic
921948649 1:220906729-220906751 TTGCAGGCACTGATGGTATTAGG - Intergenic
922015958 1:221647195-221647217 ATTCATATGCTGATGGTATTTGG - Intergenic
922408938 1:225349976-225349998 ATGTATATCCTGCTGTTATTGGG - Intronic
1065447361 10:25816942-25816964 AATTATACACTGTTGTTATTTGG + Intergenic
1065663463 10:28031753-28031775 ATGTGTATTCTGATGTTATTGGG + Intergenic
1066104522 10:32145107-32145129 TTGTCTACCCTGATGGTATTCGG - Intergenic
1068462730 10:57348865-57348887 ATGTATACTCTGTTGTTTTTTGG + Intergenic
1069347611 10:67488211-67488233 AGGGATACAAGGATGGTATTTGG + Intronic
1069698240 10:70403656-70403678 GTGTATATAGTGATGGTCTTTGG + Intergenic
1070465125 10:76714009-76714031 ATGTATACTCTGCAGTTATTAGG - Intergenic
1071454561 10:85835713-85835735 ATGTATATTCTGCTGATATTGGG - Intronic
1071852209 10:89585307-89585329 ATCTACAAAGTGATGGTATTGGG - Intronic
1072671062 10:97429562-97429584 AGGTATACTCTGAGGGTACTTGG + Intronic
1075494580 10:122908891-122908913 ATGTATCTTCTGAGGGTATTTGG - Intergenic
1079753947 11:24232601-24232623 ATGTATATACTGTAGGTGTTTGG + Intergenic
1080491476 11:32769096-32769118 GTTTACACACTGATGGTATCTGG - Intronic
1082912511 11:58392480-58392502 ATGTTTATACTGATGATAATTGG - Intergenic
1083522063 11:63323111-63323133 ATGTATATTCTGTTGGTTTTGGG - Intronic
1086075950 11:82852400-82852422 ATGTATACACTGATGGTATTAGG + Intronic
1086563830 11:88201159-88201181 ATGTATACTCTGCTGATGTTTGG + Intergenic
1086762380 11:90648626-90648648 ATGTATACACTGTTGTTTATGGG + Intergenic
1087362555 11:97179001-97179023 ATGTATATACTGCTGGTAGGAGG - Intergenic
1088037663 11:105336620-105336642 ATGTATATTCTGTTGGTTTTTGG - Intergenic
1088271036 11:108034739-108034761 AGGGATACACTGATTTTATTAGG - Intronic
1088983842 11:114888332-114888354 ATATATATAGTGATGATATTAGG - Intergenic
1091480644 12:826793-826815 ATCTAAACAATGATAGTATTAGG - Intronic
1095089109 12:38087640-38087662 GTGTATACACTCATGGGCTTGGG - Intergenic
1096330282 12:50705951-50705973 ATTTATACAGTGATGCTTTTGGG + Intronic
1098983154 12:76981628-76981650 ATGTATATACTGCTGCTGTTAGG + Intergenic
1099582758 12:84473679-84473701 ATGAATTCATTGATGGAATTAGG + Intergenic
1100243180 12:92730117-92730139 ATGTATTCACTGGTGGTCCTGGG - Intronic
1101411373 12:104471315-104471337 AGGAATACACTGATGGTAATTGG + Intronic
1104153574 12:126108622-126108644 AGATATACACTGATGTAATTGGG + Intergenic
1104176523 12:126338341-126338363 CTGTATCCACTGATGGTTATCGG + Intergenic
1104556811 12:129807553-129807575 ATGTATAAACTGCTTATATTTGG + Intronic
1105359673 13:19696562-19696584 ATATATATACTTATGGTCTTGGG + Intronic
1106534787 13:30630259-30630281 ATGTTTACATTGTTGTTATTTGG + Intronic
1106977866 13:35243924-35243946 ATGTATATTCTGATGTTATTGGG - Intronic
1107333293 13:39325346-39325368 ATGCATCCACTCATGGTTTTTGG + Intergenic
1109323960 13:60845481-60845503 CTGTATACTGTGATGGTATCTGG + Intergenic
1110166555 13:72449488-72449510 ATTTATATGTTGATGGTATTTGG - Intergenic
1111318996 13:86599546-86599568 ATGTATTTTCTGATGGTTTTGGG + Intergenic
1111819676 13:93197053-93197075 ATTTATATAGTAATGGTATTTGG - Intergenic
1112544318 13:100350381-100350403 ATGTATACACTCTTTGTGTTTGG + Intronic
1112944079 13:104904198-104904220 AAGCATACATTGAGGGTATTTGG + Intergenic
1113290787 13:108903415-108903437 ATGTATCCACTGAAGGTAAAGGG + Intronic
1113545541 13:111146277-111146299 CTGTAGACATTGATGGTATCAGG - Intronic
1114837480 14:26220609-26220631 ATGGATTCACTGATTGAATTGGG - Intergenic
1115159904 14:30382051-30382073 ATGCATTCACTGATGTTATTTGG + Intergenic
1115937898 14:38575657-38575679 ATGTATATTCTGAAGTTATTGGG + Intergenic
1118360880 14:65055404-65055426 ATGTTTACACTGGTGGAAGTAGG - Intronic
1119514651 14:75238744-75238766 ATGTCTTCCCTGCTGGTATTGGG - Exonic
1120491725 14:85186588-85186610 ATGTAATCACTGATGATATAGGG + Intergenic
1120544470 14:85793295-85793317 ATTTATTCACTGATAGAATTAGG + Intergenic
1120656005 14:87190570-87190592 ATGTCTATACTAATTGTATTAGG - Intergenic
1121625281 14:95380934-95380956 ACTTCTAAACTGATGGTATTAGG + Intergenic
1125822789 15:42647729-42647751 ATGTAATCACTGATTTTATTTGG + Intronic
1127567432 15:60205586-60205608 GTATATACAAAGATGGTATTTGG - Intergenic
1128417557 15:67460790-67460812 ATTTATAAACTGACTGTATTAGG + Intronic
1130366024 15:83239634-83239656 ATGTATATTCTGTTGCTATTGGG - Intergenic
1132245059 15:100288543-100288565 ATGTATACTCTGTTGCTTTTGGG - Intronic
1135282079 16:21160476-21160498 ATGTATGGAATGATGGAATTGGG + Intronic
1135666095 16:24336765-24336787 ATGCCTACAATGATGGTATTAGG - Intronic
1138358353 16:56404445-56404467 ATGTAAACAATGATGGTAGTAGG + Intronic
1143897824 17:10150461-10150483 ATGGATACAGTGAAGGTAGTGGG + Intronic
1144232119 17:13218029-13218051 ATGTATAGACTGAGGTTATGGGG - Intergenic
1147514655 17:41104371-41104393 ATATATACACTGAGGGTGTGTGG + Intronic
1147764098 17:42821651-42821673 ATGGATACACTGATGTAATCTGG - Intronic
1149015061 17:51899512-51899534 ATGTATATACTGTTGTTTTTGGG + Intronic
1149215958 17:54354586-54354608 ATGTATATTCTGATGTTGTTGGG + Intergenic
1152372682 17:79899880-79899902 ATTTATCCATTGATGGCATTGGG - Intergenic
1153853679 18:9123324-9123346 ATTTATACCTTGATGGTGTTGGG - Intronic
1155626323 18:27839015-27839037 ATCCATATAGTGATGGTATTTGG + Intergenic
1155790240 18:29958301-29958323 ATATATACACGGAAGCTATTTGG - Intergenic
1156221548 18:35057657-35057679 ATATATACAATGATGGTATCTGG + Intronic
1158079144 18:53567829-53567851 ATTCATACATTGATAGTATTTGG - Intergenic
1159364888 18:67452848-67452870 ATATCTACACTGATGATTTTAGG + Intergenic
1160137378 18:76283953-76283975 ATGAACACCCTGATGCTATTTGG + Intergenic
1162612153 19:11765196-11765218 ATGTATAATCTGTTGGTTTTGGG + Intergenic
1165563795 19:36705633-36705655 ATGCATATTCTGATGTTATTGGG + Intronic
926390563 2:12387046-12387068 ATGTCTAATCTGATGGTATTAGG - Intergenic
930299956 2:49602990-49603012 ATGTAGACACTGCTGGTCTGTGG + Intergenic
930586221 2:53269988-53270010 ATGTATATTCTGTTGGTTTTGGG - Intergenic
932460216 2:71877326-71877348 ATGTATACGTTGATGGTATTTGG + Intergenic
933334439 2:80938739-80938761 ATGATTACACTGATGGTATCAGG - Intergenic
933474576 2:82773165-82773187 ATGTATATTCTGAAGTTATTTGG - Intergenic
935231231 2:101098541-101098563 ATGTATACACTGTTGATTTGGGG - Intronic
935463177 2:103362824-103362846 ATATATACACTTGTGGTATGGGG + Intergenic
935481651 2:103596704-103596726 ATGTATATTCTGTTGGTGTTGGG - Intergenic
936773625 2:115945285-115945307 AGTTATACATTGATAGTATTTGG - Intergenic
937671350 2:124540866-124540888 ATGAGGACACTCATGGTATTTGG - Intronic
938791164 2:134677590-134677612 TTTTATACACTGCTGGTCTTGGG - Intronic
939405227 2:141746806-141746828 ATTAATACCCTTATGGTATTAGG + Intronic
939579825 2:143935084-143935106 AGTTATAAACAGATGGTATTTGG + Intergenic
939834863 2:147117400-147117422 ATGTATATTCTGCTGCTATTGGG + Intergenic
940600752 2:155856616-155856638 TTATAACCACTGATGGTATTTGG + Intergenic
941571377 2:167175046-167175068 ATGTATACACTGTTGATTTGGGG + Intronic
941573557 2:167201388-167201410 AGGTATATACTGAAGGTATATGG - Intronic
942702201 2:178725367-178725389 ATGGCCACACTGATGGTCTTAGG - Exonic
943577850 2:189652491-189652513 ATGTATATTCTGTTGGTTTTGGG - Intergenic
943765238 2:191653976-191653998 ATTTATATGCTGATGGTATTTGG - Intergenic
944568744 2:201020326-201020348 ATGAACACACTGAGAGTATTTGG + Intronic
945658659 2:212657410-212657432 ATGTATACTCTGTTGTTATTCGG + Intergenic
946216829 2:218190575-218190597 ATGTACACACTGATGTATTTAGG + Intergenic
946896677 2:224331071-224331093 ATCTATAGACTGATGGTGTGTGG + Intergenic
1168877785 20:1183100-1183122 TTGTATACACTGATGGCCTGAGG + Intronic
1168947205 20:1771007-1771029 ATGTAAACACTGAAGCTACTTGG + Intergenic
1170276633 20:14598689-14598711 TTGTATACACTTAGGCTATTGGG - Intronic
1172174332 20:32963004-32963026 ACGGATACAGAGATGGTATTGGG - Intergenic
1175747633 20:61469857-61469879 ATGTGTTCACTGAAGGTATGTGG + Intronic
1177760484 21:25397529-25397551 ATGTATCTTCTGATGGGATTTGG + Intergenic
1178814539 21:35915995-35916017 CTGTATAGAATGATGCTATTCGG - Intronic
1179915295 21:44473645-44473667 AGGTATACAGTTATGGTAGTTGG + Intergenic
1182235451 22:28872277-28872299 ATGTATACACAGGTGCTATCTGG - Intergenic
1182400166 22:30069546-30069568 ATGTATAGTCTGCTGGTTTTGGG - Intergenic
1184056632 22:42055562-42055584 ATGTATATTCTGCTGCTATTGGG + Intronic
949165881 3:940390-940412 ATGTATATTCTGTTGTTATTAGG - Intergenic
949376663 3:3398175-3398197 ATGTATATTCTGATGTTATTGGG + Intergenic
950299630 3:11865444-11865466 ATGTATACTCTGTTGATTTTGGG + Intergenic
950823389 3:15787612-15787634 ATGTACACACATATGGTTTTAGG + Intronic
951541805 3:23789091-23789113 ATGTGTACACTGATTGTCTGGGG + Intergenic
952785571 3:37151511-37151533 ATGTATACACTGTTACTATTAGG - Intronic
956198592 3:66679986-66680008 ATGTTTACTCTGCTGGTAATGGG + Intergenic
956857022 3:73285350-73285372 ATGTATACATTCATGGTATCTGG + Intergenic
957766218 3:84628504-84628526 ATGTACACGCTGATGGAATGTGG - Intergenic
958663629 3:97105616-97105638 ATGTATATTCTGTTGGTTTTGGG + Intronic
959455786 3:106559685-106559707 ATGTATGCTTTAATGGTATTAGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
963925590 3:150947580-150947602 ATGTATATTCTGTTGGTTTTGGG - Intronic
965899528 3:173621496-173621518 AAGTATGCATTGATGGTTTTTGG + Intronic
966540110 3:181079599-181079621 AAGTTTAAAGTGATGGTATTTGG - Intergenic
966540283 3:181081796-181081818 AAGTTTAAAGTGATGGTATTTGG - Intergenic
968877162 4:3277570-3277592 AAGTAGACACTGGTGCTATTAGG - Intergenic
969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG + Intronic
970734966 4:19155021-19155043 ATGTATATACTGTTGTTTTTGGG + Intergenic
970754179 4:19404178-19404200 AAGGATCCACTGATGATATTAGG - Intergenic
971053362 4:22886068-22886090 ATGCATACATTGATGCTATTGGG + Intergenic
972124316 4:35743799-35743821 ATGTATATTCTGTTGGTTTTGGG - Intergenic
972140655 4:35955498-35955520 ATGTATATTCTGTTGTTATTAGG + Intronic
972437346 4:39046141-39046163 ATGAATACACTGACGTTGTTGGG + Intronic
973027993 4:45297959-45297981 ATGTATACTCTGCTTTTATTGGG + Intergenic
973034390 4:45388252-45388274 ATGTATACTCTGTTGTTGTTGGG + Intergenic
973114086 4:46433185-46433207 AAGTATATACTTATGCTATTGGG - Intronic
973208968 4:47593695-47593717 ATGTATAAAATAATTGTATTGGG + Intergenic
974167349 4:58220807-58220829 ATGAATTCACTGTTGGTATATGG - Intergenic
974194365 4:58552660-58552682 ATTTCTACAATGATGGTATAGGG + Intergenic
974391561 4:61276858-61276880 ATGTCTACTCTGATAATATTGGG - Intronic
974483250 4:62473315-62473337 ATGTATATACTCATGTTACTGGG + Intergenic
975960313 4:79896076-79896098 ATGTATATTCTGTTGCTATTTGG + Intergenic
976376342 4:84349906-84349928 ATTCATACATTGATGGCATTTGG - Intergenic
976941896 4:90712601-90712623 ATGTATACACTGTTGTTTTGGGG + Intronic
977652116 4:99482665-99482687 ATGTATACTCTGTTGTTTTTGGG + Intergenic
978099446 4:104819840-104819862 ATTTATCTACTGATGGTAGTAGG + Intergenic
978237674 4:106479049-106479071 ATTTATATGTTGATGGTATTTGG + Intergenic
978490689 4:109308512-109308534 ATGTATACAATTATGCTATGGGG + Intergenic
978627735 4:110706402-110706424 ATATATATGTTGATGGTATTTGG + Intergenic
980056201 4:128082427-128082449 AAATATACCCTGAAGGTATTTGG - Intronic
980580859 4:134748045-134748067 ATGTATACTCTGTTGTTGTTGGG - Intergenic
980648494 4:135677790-135677812 ATGTATATTCTGCTGATATTCGG - Intergenic
981337648 4:143584806-143584828 ATGTATATTCTGTTGGTTTTGGG - Intronic
983997816 4:174206665-174206687 TTGTATACACTGATAGTAGCCGG - Intergenic
984370095 4:178852820-178852842 ATGTCTGCATTGATGGTGTTAGG + Intergenic
985326230 4:188773918-188773940 ATGTATACTCTGCAGTTATTGGG + Intergenic
985333978 4:188872041-188872063 TTGGATACACTGATGTCATTCGG - Intergenic
988128731 5:27075975-27075997 ATGTATATTCTGTTGGTTTTGGG - Intronic
988306087 5:29496181-29496203 ATGTATATTCTGCTGGTTTTGGG + Intergenic
988916630 5:35900892-35900914 ATGTATTCACAGATGGTGTGTGG - Intergenic
989461655 5:41706433-41706455 ATATATATACTGCTGTTATTGGG + Intergenic
989654891 5:43735701-43735723 ATGTACACACTAATCGTACTAGG - Intergenic
992161772 5:74011354-74011376 ATCTCTAAAGTGATGGTATTTGG - Intergenic
993432058 5:87843687-87843709 ATATATAAAATGGTGGTATTGGG + Intergenic
993626045 5:90225903-90225925 ATTTATACACTGAAATTATTAGG + Intergenic
994292725 5:98048678-98048700 ATGTATACAATGATCACATTAGG - Intergenic
994713997 5:103300226-103300248 ATGTAACCAGTGATGGTATGTGG - Intergenic
994942610 5:106344540-106344562 ATGTATACACTGATATGGTTTGG + Intergenic
999671579 5:153963386-153963408 ATCTGTACACTGATGATTTTAGG - Intergenic
1000851130 5:166341321-166341343 ATGCATACAGTGAAGGTATTAGG - Intergenic
1002674689 5:180901312-180901334 ATGTATCCATTTATGGTATATGG - Intronic
1002683853 5:180991384-180991406 ATGTATCCATTTATGGTATATGG - Intronic
1008082946 6:47212699-47212721 ATGTATATTCTGTTGGTTTTGGG - Intergenic
1008358849 6:50590815-50590837 ATGTAGACACAGATGATTTTAGG - Intergenic
1009532738 6:64842062-64842084 GTGCAAACACTGATGATATTTGG - Intronic
1010600076 6:77814037-77814059 AGGTGTATACTGATGGTTTTTGG - Intronic
1012079650 6:94739437-94739459 ATGTATACACTGCAGATTTTGGG - Intergenic
1012337778 6:98082564-98082586 ATGTATATTCTGATGGTTTTCGG + Intergenic
1012619404 6:101322279-101322301 ATGTATAGTCTGTTGGTTTTGGG + Intergenic
1012710318 6:102593552-102593574 ATATATACATATATGGTATTTGG - Intergenic
1012723081 6:102772831-102772853 ATGCATATGTTGATGGTATTTGG + Intergenic
1013984989 6:116180762-116180784 ATTTATTCACTGATGAAATTGGG - Intronic
1014106274 6:117566187-117566209 ATATTTGCACTGATGGTATCTGG - Intronic
1015044860 6:128764843-128764865 ATGTATATCCTGTTGGTTTTGGG - Intergenic
1016073880 6:139773716-139773738 AGGTATACACTGAGGGTGATAGG - Intergenic
1016847702 6:148585366-148585388 ATGTTTACTCTGTTGGTTTTGGG + Intergenic
1019968231 7:4518743-4518765 ATGTATACGCTGGTGTTGTTGGG - Intergenic
1019970958 7:4540334-4540356 ATCTATAAACTGATGGGGTTTGG + Intergenic
1020623991 7:10555985-10556007 ATGTATACTTTGCTGTTATTGGG - Intergenic
1021007941 7:15423463-15423485 ATGTATACAATGGTGGAATGGGG - Intronic
1022386860 7:29908514-29908536 ATGTATATACTGCTGTTGTTGGG - Intronic
1027998110 7:85452825-85452847 ATGTATAAACTGAATGTAGTTGG - Intergenic
1030518646 7:110568669-110568691 AGGCATCCACTGAGGGTATTGGG - Intergenic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1033526467 7:142219267-142219289 ATGAGTGCCCTGATGGTATTTGG + Intronic
1034505940 7:151491103-151491125 ATGAAGACACTGAAGGTATCAGG + Intronic
1034719656 7:153278811-153278833 ATGTATACTCTGATATCATTGGG - Intergenic
1037315821 8:17598564-17598586 ATGTGTACACTGCATGTATTGGG + Intronic
1039338462 8:36620926-36620948 ATGAAAACACCTATGGTATTTGG + Intergenic
1041519859 8:58743544-58743566 ATTCATACACTGATTTTATTGGG - Intergenic
1041999153 8:64101864-64101886 TTGTATACACCTATGATATTTGG - Intergenic
1042131156 8:65587831-65587853 ATTTATATACTGATGGTATTAGG - Intergenic
1043105301 8:76102104-76102126 ATGTATCCTGGGATGGTATTGGG + Intergenic
1043182041 8:77097156-77097178 CTTTCTACACTGATGATATTTGG - Intergenic
1043194870 8:77279360-77279382 ATGAATGCAGAGATGGTATTTGG - Intergenic
1043269517 8:78313886-78313908 ATGTATACAGTTGTGTTATTAGG + Intergenic
1043616588 8:82132481-82132503 ATGTATACACTGAAGTTGTTGGG - Intergenic
1043685174 8:83075592-83075614 ATGTATATTCTGCTGTTATTGGG - Intergenic
1045390853 8:101712955-101712977 ATGTATACACTGTTGATTTGGGG - Intronic
1045420242 8:102007414-102007436 ATGTATCAACTGATGAAATTCGG - Intronic
1045586781 8:103546558-103546580 ATGTATATTCTGTTGGTTTTGGG - Intronic
1045633910 8:104160201-104160223 ATTTATAGTCTGATGGGATTTGG - Intronic
1047242440 8:123103885-123103907 ATAAAGACACTGATGGTACTGGG - Intronic
1047357050 8:124132025-124132047 ATGTATATTCTGTTGGTTTTGGG - Intergenic
1050886489 9:10772983-10773005 AAGTATAAACTTATGGTTTTTGG + Intergenic
1051884827 9:21880091-21880113 ATTTATATATTGATGGCATTTGG + Intronic
1052583448 9:30392050-30392072 ATGTATAATCTGTTGGTTTTGGG - Intergenic
1059389957 9:113992789-113992811 ATGGACACACAGATGGCATTTGG + Intronic
1061744070 9:132726987-132727009 ATGAATGCAGTGATTGTATTTGG + Intronic
1185815592 X:3152190-3152212 ATGGAACCACTGATGGAATTTGG - Intergenic
1187219988 X:17315409-17315431 ATGTATAGTCTGCTGCTATTGGG - Intergenic
1187237417 X:17480784-17480806 ATGCATACCCTGATGGTATGGGG + Intronic
1187607574 X:20903229-20903251 ATGTATACTCTGTTGTTTTTGGG + Intergenic
1188931121 X:36112566-36112588 ATGTATACCCTGTTGCTTTTGGG + Intronic
1189557440 X:42160245-42160267 ATGTATACTCTGTTGTTTTTGGG + Intergenic
1189581404 X:42411172-42411194 ATGTATATTCTGTTGGTTTTTGG + Intergenic
1189861774 X:45279749-45279771 ATGTATATTCTGTTGTTATTGGG + Intergenic
1191663260 X:63672032-63672054 ATCTCTACTGTGATGGTATTTGG + Intronic
1191712111 X:64161019-64161041 ATGTATTCCCTGGTGGTCTTTGG - Intergenic
1191944090 X:66512309-66512331 ATGTATACTCTGTTGTTGTTGGG + Intergenic
1192307118 X:69973183-69973205 GGGTATACACTGGAGGTATTGGG - Intronic
1193218808 X:78898516-78898538 ATGCATACACTGGTGGCAGTGGG + Intergenic
1193484260 X:82067089-82067111 AAATATACACTGATTGTGTTAGG + Intergenic
1193497673 X:82234577-82234599 ATGTATATTCTGTTGGTTTTGGG + Intergenic
1193595176 X:83437003-83437025 ATGTATATTCTGTTGGTTTTGGG + Intergenic
1194093535 X:89606545-89606567 ATGTATACATTGATGTGGTTTGG + Intergenic
1194287061 X:92022697-92022719 ATGTATACTCTGTTGATTTTTGG - Intronic
1195038688 X:100993734-100993756 AAGGGTACACTGATTGTATTGGG - Intergenic
1195432506 X:104805051-104805073 ATGTATACACTGGACGTTTTAGG - Intronic
1195667546 X:107444672-107444694 AGGTAAACACAGATGGTAATTGG - Intergenic
1197428320 X:126325615-126325637 ATGTATACTCTGTTGTTTTTGGG - Intergenic
1198668965 X:139057066-139057088 ATCTATAAAATGATGGGATTGGG + Intronic
1199300442 X:146207294-146207316 ATGTAGACAATGAAGATATTAGG + Intergenic
1199301211 X:146216253-146216275 ATTTATTCACTGATGTTATAAGG + Intergenic
1200365708 X:155660484-155660506 ATGTATATACTGCTGTTGTTAGG + Intronic
1200446163 Y:3262647-3262669 ATGTATACATTGATGTGGTTTGG + Intergenic
1201956678 Y:19632330-19632352 ATGTATACTCTGTTGATTTTGGG + Intergenic
1201982098 Y:19918979-19919001 AGGTAGACACTGTTGGTTTTGGG + Intergenic