ID: 1086079574

View in Genome Browser
Species Human (GRCh38)
Location 11:82889397-82889419
Sequence AAGAAGAAGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8787
Summary {0: 7, 1: 78, 2: 387, 3: 1670, 4: 6645}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086079569_1086079574 0 Left 1086079569 11:82889374-82889396 CCAACAAAATAAAAAAGAGGAAG 0: 1
1: 0
2: 13
3: 255
4: 2176
Right 1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG 0: 7
1: 78
2: 387
3: 1670
4: 6645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086079574 Original CRISPR AAGAAGAAGGAGAAGGAGGA GGG Intronic
Too many off-targets to display for this crispr