ID: 1086087806

View in Genome Browser
Species Human (GRCh38)
Location 11:82972515-82972537
Sequence GTGAATAAATGGATGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086087800_1086087806 2 Left 1086087800 11:82972490-82972512 CCCTATGGTACATGTTCAATAAG No data
Right 1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG No data
1086087801_1086087806 1 Left 1086087801 11:82972491-82972513 CCTATGGTACATGTTCAATAAGT No data
Right 1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG No data
1086087799_1086087806 6 Left 1086087799 11:82972486-82972508 CCTGCCCTATGGTACATGTTCAA No data
Right 1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086087806 Original CRISPR GTGAATAAATGGATGGGTGA AGG Intergenic
No off target data available for this crispr