ID: 1086089358

View in Genome Browser
Species Human (GRCh38)
Location 11:82989861-82989883
Sequence AATGTCCTATAGATGCCGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086089358_1086089360 2 Left 1086089358 11:82989861-82989883 CCTTTCGGCATCTATAGGACATT 0: 1
1: 0
2: 1
3: 0
4: 82
Right 1086089360 11:82989886-82989908 TATATGCAAGGTACTGTGCTAGG 0: 1
1: 6
2: 83
3: 578
4: 2486
1086089358_1086089359 -10 Left 1086089358 11:82989861-82989883 CCTTTCGGCATCTATAGGACATT 0: 1
1: 0
2: 1
3: 0
4: 82
Right 1086089359 11:82989874-82989896 ATAGGACATTAATATATGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 247
1086089358_1086089361 9 Left 1086089358 11:82989861-82989883 CCTTTCGGCATCTATAGGACATT 0: 1
1: 0
2: 1
3: 0
4: 82
Right 1086089361 11:82989893-82989915 AAGGTACTGTGCTAGGCACATGG 0: 1
1: 1
2: 18
3: 152
4: 932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086089358 Original CRISPR AATGTCCTATAGATGCCGAA AGG (reversed) Intronic