ID: 1086094224

View in Genome Browser
Species Human (GRCh38)
Location 11:83034388-83034410
Sequence CAGCTTTGCCCCAAAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 203}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086094216_1086094224 7 Left 1086094216 11:83034358-83034380 CCCTCCCCCTGCAGCTAAGAATC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 203
1086094219_1086094224 2 Left 1086094219 11:83034363-83034385 CCCCTGCAGCTAAGAATCTCTGA 0: 1
1: 0
2: 1
3: 8
4: 177
Right 1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 203
1086094213_1086094224 16 Left 1086094213 11:83034349-83034371 CCTGCCAGCCCCTCCCCCTGCAG 0: 1
1: 3
2: 12
3: 167
4: 1326
Right 1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 203
1086094214_1086094224 12 Left 1086094214 11:83034353-83034375 CCAGCCCCTCCCCCTGCAGCTAA 0: 1
1: 0
2: 4
3: 70
4: 594
Right 1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 203
1086094215_1086094224 8 Left 1086094215 11:83034357-83034379 CCCCTCCCCCTGCAGCTAAGAAT 0: 1
1: 0
2: 1
3: 20
4: 254
Right 1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 203
1086094217_1086094224 6 Left 1086094217 11:83034359-83034381 CCTCCCCCTGCAGCTAAGAATCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 203
1086094220_1086094224 1 Left 1086094220 11:83034364-83034386 CCCTGCAGCTAAGAATCTCTGAG 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 203
1086094221_1086094224 0 Left 1086094221 11:83034365-83034387 CCTGCAGCTAAGAATCTCTGAGC 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 203
1086094218_1086094224 3 Left 1086094218 11:83034362-83034384 CCCCCTGCAGCTAAGAATCTCTG 0: 1
1: 0
2: 0
3: 14
4: 214
Right 1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086094224 Original CRISPR CAGCTTTGCCCCAAAGAGCA GGG Intronic
900646788 1:3712722-3712744 CAGCATTGCCCCTATGTGCAGGG + Intronic
901310890 1:8268729-8268751 CAGTTTTGCCCCAAATGACATGG + Intergenic
901758465 1:11455609-11455631 CTGCCTCGCCCCAAGGAGCAAGG + Intergenic
902132251 1:14272533-14272555 GTGCCTTGCTCCAAAGAGCAAGG + Intergenic
903259382 1:22123136-22123158 AATCTTTGCCCCAAAGACCAAGG + Intronic
904198200 1:28801795-28801817 CAGCTTCTCTCCACAGAGCATGG - Intergenic
904818857 1:33227303-33227325 CAGCTTTGACCAATAGAGTATGG + Intergenic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
908190568 1:61699226-61699248 CAGCTCTGCCCCAAGCAGCTGGG - Intronic
908711464 1:67020153-67020175 CAGCTTAGCTCTGAAGAGCATGG - Intronic
909492210 1:76238244-76238266 TAGCTTTGCTTCAAAGAGCACGG - Intronic
910975573 1:92902253-92902275 CAGCTCTGGCCCAAAGGGCAGGG + Intronic
911055635 1:93706046-93706068 CTGCTCTGCCCCAGAGTGCAGGG - Intronic
911566819 1:99472131-99472153 CAGCTTTTCCCCAAAGGAAAGGG - Intergenic
912528750 1:110304808-110304830 CAGCCGTGCCCCAAAGGGGAGGG + Intergenic
916973032 1:170044571-170044593 TGACATTGCCCCAAAGAGCATGG - Intronic
921625297 1:217372790-217372812 CAGCTGTGCCTGAAAGTGCAGGG - Intergenic
923183443 1:231546787-231546809 CAGCAGAGCCCCAGAGAGCATGG - Intronic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
924531014 1:244893932-244893954 CTGCTTTGACCGATAGAGCATGG + Intergenic
1063796407 10:9517968-9517990 CAGCTCAGCACCACAGAGCAAGG + Intergenic
1064128803 10:12689252-12689274 CAGCTTTGCTTGAAAGAGCAGGG - Intronic
1066301667 10:34102584-34102606 CGGCTTTGGCCCTGAGAGCACGG - Intergenic
1070252129 10:74782199-74782221 CAACTTTCCCCCAAATAGAAGGG + Intergenic
1070646498 10:78205550-78205572 GAGCCTTGCCCCAGAGAGCACGG + Intergenic
1071759332 10:88583082-88583104 CAGCCTTGTCCCACACAGCAAGG + Exonic
1072736786 10:97884505-97884527 CAGCATTGCTCCAGAGAGGAGGG - Intronic
1074033737 10:109716708-109716730 CAGCCTTGCTCCCAAGGGCAGGG + Intergenic
1074696512 10:116054334-116054356 CCTCTTTCCTCCAAAGAGCAAGG + Intergenic
1075014691 10:118901961-118901983 AAAATTTCCCCCAAAGAGCATGG + Intergenic
1076606467 10:131692754-131692776 CAGCTCACCCCCAAAGACCACGG - Intergenic
1077297738 11:1834027-1834049 CTGCTTTGCCCACAAGAGCCTGG - Intronic
1081099313 11:38982545-38982567 CAGCTTGGCCTCACAGGGCAGGG - Intergenic
1084088419 11:66865319-66865341 CAGCTTTGCTCCAGAGTCCAAGG - Intronic
1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG + Intronic
1087489756 11:98810044-98810066 TAGTTTTCCACCAAAGAGCAAGG - Intergenic
1088049690 11:105497196-105497218 CATCTTTCTTCCAAAGAGCATGG - Intergenic
1089656234 11:119948818-119948840 CAGCTCTGCCCCAGGGTGCATGG + Intergenic
1090490690 11:127158068-127158090 CAGCTTGGCACCAAAAAGAAAGG - Intergenic
1091290708 11:134437990-134438012 CAGCTGTGGGCCAAACAGCATGG + Intergenic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1092009985 12:5101655-5101677 AAACTTTGCCCCAAAGACAAAGG - Intergenic
1094118024 12:26938392-26938414 CCGCTTTGCCCCAGAAGGCAGGG - Exonic
1094376839 12:29799778-29799800 CAGCTCTGCCCCACAGGGCTTGG + Intergenic
1097500161 12:60392037-60392059 CAGCTGTGCCTCAAAGGGTAGGG - Intergenic
1100274252 12:93057611-93057633 AAACTGAGCCCCAAAGAGCAGGG + Intergenic
1100722319 12:97372104-97372126 CAGCCTTCCCCCAAGTAGCAGGG - Intergenic
1103722686 12:122982985-122983007 CAGCTTTGCCCAAAAGCTCCCGG - Intergenic
1105535335 13:21260004-21260026 GACCTTTGACCCAGAGAGCAGGG - Intergenic
1105763337 13:23533388-23533410 CAGCTTTACCCCCAAGAAAAAGG + Intergenic
1108122435 13:47203779-47203801 CAGCTTTCTCCCTAAGATCAAGG + Intergenic
1108262055 13:48668164-48668186 CATATATCCCCCAAAGAGCAAGG + Intronic
1109082269 13:57919439-57919461 CCACTTTCCCCCACAGAGCAGGG - Intergenic
1109846713 13:68002268-68002290 CAGCTTTTCCTCTAAGATCAGGG - Intergenic
1111161857 13:84405340-84405362 CTGCTGTGCACCAAAGAGCAAGG - Intergenic
1111233224 13:85372404-85372426 CAACTCTGTCCCAGAGAGCAGGG - Intergenic
1112268000 13:97942989-97943011 CACCTTTGCTCAAAAGAGCACGG - Intergenic
1113891265 13:113736791-113736813 CAGCTCTGCCCCAAGGCTCACGG - Exonic
1113947337 13:114051585-114051607 CAGTATTGCCCCAAAAACCAGGG + Intronic
1114587944 14:23831967-23831989 CAGCTCAGCCTCCAAGAGCATGG + Intergenic
1118862097 14:69672472-69672494 CAGCTTTGGGGCAAAGAACAGGG + Intronic
1118905630 14:70021233-70021255 CTGCCTTTCCCCAAACAGCAGGG - Intronic
1120656088 14:87191537-87191559 CAGCTTTGCCTTAAGGAGCCTGG - Intergenic
1121409716 14:93741329-93741351 CAGCTGTAGCCCAAAGATCAGGG - Intronic
1122347849 14:101071504-101071526 CAGCCTTGCTCCAAGGAGAAGGG + Intergenic
1122745942 14:103897288-103897310 CAGCTTTCCCCAAACCAGCAGGG + Intergenic
1126063455 15:44806288-44806310 CAGCTCTGCACCAGAGAGCCTGG - Intergenic
1126688275 15:51267067-51267089 CAGCTTTGCTCTCCAGAGCAGGG - Intronic
1127999172 15:64174974-64174996 AAAATTTGCCCCAAAGAGCTTGG - Intronic
1128219019 15:65954668-65954690 CACCTGTGCCCCAAAGTTCAAGG + Intronic
1128476006 15:67997344-67997366 CCCCTTTCCCCCCAAGAGCAAGG + Intergenic
1128615943 15:69109857-69109879 CAGCTCTGCCCCAGTGACCAAGG + Intergenic
1128671841 15:69579461-69579483 CAGCTTAGCGCCAAAAGGCACGG - Intergenic
1129319219 15:74764654-74764676 CAGCTTCCCCTCACAGAGCACGG - Intergenic
1129386347 15:75198255-75198277 CTGCTTTGCCACAGTGAGCAGGG - Intronic
1130394494 15:83490191-83490213 CAGCTTAGACCCACAGAGAAGGG - Intronic
1130898833 15:88191999-88192021 CAGCTGTGCGCCAAGGACCACGG + Intronic
1133584649 16:7181229-7181251 CTGCTATGCCCCGATGAGCATGG + Intronic
1134257618 16:12625149-12625171 TTGCTTTGCCCCACAAAGCAGGG - Intergenic
1134315875 16:13118352-13118374 CAGCTGAGCCCTAAAGAGCAAGG + Intronic
1135758797 16:25119735-25119757 TAGCTATGCCCCAGAGAGTAAGG + Intronic
1137792795 16:51188988-51189010 CACCTCAGCCCCACAGAGCAAGG + Intergenic
1140233959 16:73141884-73141906 CAGATTTGCAACAAAGAGCAGGG + Intronic
1140314356 16:73880191-73880213 CAGATTTGCCCCAAAAAGCAAGG + Intergenic
1142408266 16:89903124-89903146 CAGCTCTGCCACAAAGGACAGGG - Intronic
1143372937 17:6451648-6451670 CTCCTTTGCCCCAAAGAGGGTGG + Exonic
1143379250 17:6485665-6485687 CAGCTTTACCCTAAAGCTCATGG - Intronic
1144875301 17:18394292-18394314 GGGCTTTGGCCCAAAGAGAATGG + Intergenic
1145156923 17:20550129-20550151 GGGCTTTGGCCCAAAGAGAATGG - Intergenic
1148150534 17:45394379-45394401 CCGCTTTGCCACGAAGAGCTGGG - Exonic
1150567178 17:66351949-66351971 CAGTTTAGACCCTAAGAGCAGGG - Intronic
1150814670 17:68383621-68383643 CAGCTTAGGGCCAAAGGGCAGGG - Intronic
1152013175 17:77733257-77733279 CATCTTTTCCCCAGAAAGCAGGG + Intergenic
1153109416 18:1566355-1566377 CAGGTTTTCCCCAAAAAACATGG + Intergenic
1154004781 18:10517726-10517748 CTGCTTTGACCAAAAGAACAAGG - Intergenic
1156708950 18:39918504-39918526 CATCTTTGGCCCAAAGAACATGG - Intergenic
1156732288 18:40208554-40208576 CCACTTTGCCCCAACCAGCATGG - Intergenic
1157963827 18:52185722-52185744 CAGATATGCCCCAAATAGAATGG - Intergenic
1158943117 18:62424665-62424687 CAGATTCTCCCCAAAGAACATGG + Intergenic
1161152278 19:2716228-2716250 CACCTGTGCCCCAGAGAGCAGGG - Exonic
1163546382 19:17943449-17943471 CAGCCTTGCCCCGAAAAGCCCGG - Intronic
1166208878 19:41292478-41292500 CACCGTTGGACCAAAGAGCAAGG + Exonic
1166908348 19:46132238-46132260 CAGCTATGCCACAGGGAGCAAGG - Intergenic
1168551711 19:57301909-57301931 CAGCTTGGGCCCAAAGGGCCAGG + Intergenic
925027172 2:619289-619311 AGGCTTTGCTCAAAAGAGCAAGG + Intergenic
926213878 2:10891556-10891578 CAGCTCTGCTCCAGGGAGCATGG + Intergenic
926335421 2:11859132-11859154 CAGCCTTGGCCCAAAGGGCATGG - Intergenic
926913037 2:17869213-17869235 CTCCTTTGCCCTAAATAGCATGG + Intergenic
929565063 2:42978890-42978912 CACCTTTACCCCAAAAAGGAAGG + Intergenic
931734049 2:65177964-65177986 CAGCTGTGCCCCGGAGGGCAGGG + Intergenic
931963023 2:67502823-67502845 CAGTTTACTCCCAAAGAGCACGG - Intergenic
932871895 2:75409450-75409472 CAGAGTTTCCCAAAAGAGCAAGG - Intergenic
933252054 2:80039527-80039549 AGGCTTTGCCTAAAAGAGCAGGG + Intronic
933464408 2:82634243-82634265 CAGCTTAGCCCCAAAGAAGTGGG + Intergenic
934706342 2:96484300-96484322 CGGCTTTACCCCAAGGAGTAGGG + Intergenic
935205399 2:100892534-100892556 CAGCCTTGTCCCAAGGAGCCGGG - Intronic
935925601 2:108065249-108065271 CTGCTATGTCCCAAAGGGCAGGG - Intergenic
935957465 2:108391869-108391891 CAGCCTTTCCCCAGAGAGGAAGG - Intergenic
939102184 2:137907713-137907735 TACCATTTCCCCAAAGAGCATGG + Intergenic
939994030 2:148903281-148903303 CAGGTCTGCCCACAAGAGCATGG + Intronic
940046968 2:149420271-149420293 CTGCTCTGCTACAAAGAGCAGGG - Intronic
943369478 2:187000639-187000661 CACCTTTGCCTCATGGAGCATGG + Intergenic
943670983 2:190659947-190659969 CAGATTTGACTCAAAGAGGAAGG + Exonic
945597649 2:211815421-211815443 CACCTTTTCCCAAAAGAGTAAGG + Intronic
947860252 2:233353414-233353436 CTGATTTGCCCCTCAGAGCAGGG + Intergenic
948100246 2:235367239-235367261 GAGCTTTGTCATAAAGAGCAGGG - Intergenic
948495964 2:238350188-238350210 GAGTTTTGCCACAAAGAGAAGGG + Intronic
1169309233 20:4521326-4521348 CAGCTGTGCCCGGAAGGGCAGGG - Intergenic
1170782434 20:19437830-19437852 CCACCATGCCCCAAAGAGCAGGG - Intronic
1172098796 20:32473634-32473656 GAACTTTGACCCAAACAGCAAGG + Intronic
1174884956 20:54323507-54323529 CAGGTTTCCCCTAAAGGGCATGG - Intergenic
1174954176 20:55078014-55078036 CAACTTTCTCCCAAAGAGTAAGG - Intergenic
1175599726 20:60263435-60263457 CAGCTTTCCCCCAAGGAACCAGG - Intergenic
1176058496 20:63161375-63161397 AAGCTTTGCACCCAAGAACAAGG + Intergenic
1176454060 21:6892426-6892448 AATCATTTCCCCAAAGAGCACGG + Intergenic
1176898993 21:14417247-14417269 CAGCTCTGCCCCAAAGGCCAGGG - Intergenic
1178899539 21:36588101-36588123 CTGCTTTGCACCAAGGAGCCCGG - Intergenic
1178978223 21:37238999-37239021 CAGCGCTGCCCAGAAGAGCACGG - Intronic
1179906130 21:44424245-44424267 CAGCCCTGCCCCACAGAGCAAGG - Intronic
1179971331 21:44837856-44837878 CAGCTTGGCCCCAAACACCCTGG - Intergenic
1179999426 21:44988332-44988354 TAGCTCCGCCCCAGAGAGCACGG - Intergenic
1184342464 22:43893499-43893521 CATCCTTGCCTCAAAGACCATGG + Intergenic
1185308011 22:50133177-50133199 CAGCCCTGCCCCTAAGACCAGGG - Intronic
951683716 3:25321780-25321802 GAGCTTTCTACCAAAGAGCAAGG - Intronic
952859746 3:37803153-37803175 CAGCTTTGAAACAAAGAACACGG - Intronic
953805708 3:46065682-46065704 CAGATCTGACCCAGAGAGCAAGG - Intergenic
955303681 3:57809081-57809103 CAGCTGTGCCCGGAAGGGCAGGG - Intronic
955975392 3:64475184-64475206 CAGCTAAGTGCCAAAGAGCAAGG + Intergenic
962676803 3:137763875-137763897 CAGCTTTGCCGCGAAATGCAAGG - Intergenic
965406482 3:168275773-168275795 TGGGATTGCCCCAAAGAGCATGG + Intergenic
967255901 3:187591545-187591567 CAGCTGTGGCAGAAAGAGCAGGG - Intergenic
968057742 3:195705595-195705617 CAGTTTAGCCCTAAAGAGCCAGG + Intergenic
968986120 4:3875370-3875392 CCGTTTCACCCCAAAGAGCAAGG - Intergenic
969660151 4:8522734-8522756 CAGTTTGGCCCCAAAGCTCAGGG + Intergenic
972565259 4:40263925-40263947 CAGCTGAGACCCTAAGAGCATGG + Intergenic
973931909 4:55802015-55802037 CAGCTCTGCCCCAGTAAGCAGGG - Intergenic
974697534 4:65395999-65396021 CAGCTGTGCCTAGAAGAGCAGGG - Intronic
975254442 4:72216680-72216702 CAGCTGTGCCCAGGAGAGCAGGG + Intergenic
976509982 4:85897195-85897217 CAGCATTGAGGCAAAGAGCAGGG - Intronic
977518844 4:98055995-98056017 CAGCTTTCCCCCAGAGCCCATGG + Intronic
978881635 4:113710455-113710477 CAGGTGTGTGCCAAAGAGCAAGG - Intronic
981600318 4:146481162-146481184 CTGCTTAGCCCCAGAAAGCATGG - Intronic
981951577 4:150415335-150415357 CAGCTTTGTCCAGAAGAGCAAGG + Intronic
985677687 5:1240678-1240700 CGGCTGTGCCCCACAGAGCCAGG - Intronic
986004401 5:3656165-3656187 AAGCTGGGCCCCAAAGAGCAGGG - Intergenic
986177680 5:5365645-5365667 CACCACTGCCCCAAAGAGCGGGG + Intergenic
990507858 5:56462511-56462533 CAGTTTGGCCCCAAAAATCATGG - Intronic
992391262 5:76332875-76332897 CAGCATTGCCCCTAAGTCCAAGG + Intronic
994975860 5:106804618-106804640 CAGATATACCCCAAAGAGCCTGG + Intergenic
996856686 5:128016120-128016142 CAGCTTTGCCCCACACTGCCTGG + Intergenic
999175047 5:149626121-149626143 CATCCTTGCCCCAAAGGGGATGG - Intronic
1002315107 5:178338419-178338441 CTGCCTTCCCGCAAAGAGCATGG + Intronic
1002602721 5:180363207-180363229 CAGCTCAGCACCAAAGGGCATGG + Intergenic
1005016985 6:21383864-21383886 CAGCTTTGCCCCATGGAGTCGGG - Intergenic
1005598837 6:27406159-27406181 CAGCATTGCTCCAGAGAGCCAGG - Intergenic
1006798775 6:36746432-36746454 CAGCTTGGCCCCGAAGCCCAGGG + Exonic
1007179897 6:39922514-39922536 TAGCATTGTCCCATAGAGCATGG - Intronic
1007505436 6:42331862-42331884 GAGCTCTGCCCCAAAGAGTTAGG + Intronic
1008224615 6:48899312-48899334 CAGCATAGCACGAAAGAGCATGG - Intergenic
1009902534 6:69825839-69825861 CAGCTTTACCTCAAGGAGGATGG + Intergenic
1016873821 6:148844930-148844952 CAGCTTTGCTGCAAAGAACATGG + Intronic
1017259352 6:152369184-152369206 AAGCTTTGGCCCAGAGAACATGG + Intronic
1017811869 6:157989637-157989659 CAGCTCTGCCCCCAGGAGCGTGG - Intronic
1019362348 7:611385-611407 CAGCCCTGACCCAAATAGCAGGG - Intronic
1019416081 7:927002-927024 CATCTCTGCCCCAGAGAGCGAGG + Intronic
1019898003 7:3998031-3998053 CAGCTGTGCCCAAGAGGGCAGGG + Intronic
1021021235 7:15600402-15600424 CAGCTGTGCCCAGAAGGGCAGGG + Intergenic
1021697356 7:23287726-23287748 CAGCCTTGCCACACACAGCAAGG - Intergenic
1023366998 7:39474687-39474709 CAGCTTAGCCCAATAGAGCAGGG - Intronic
1023514557 7:40988071-40988093 CAATTCTCCCCCAAAGAGCATGG + Intergenic
1024014559 7:45300196-45300218 AAGCTTTTCCCCTAAGACCATGG + Intergenic
1024931969 7:54673569-54673591 CAGCTGGGCCCCAAAGAAGATGG + Intergenic
1026991177 7:74586672-74586694 GGGGGTTGCCCCAAAGAGCAGGG - Intronic
1026994185 7:74605253-74605275 CAGCTCTGTCCCAGAGTGCATGG - Intergenic
1028899440 7:96080407-96080429 CAGCTTGGGCCCAACGAACACGG - Exonic
1030930121 7:115512447-115512469 CAGCTTTCCCCCAAGTAGCTAGG + Intergenic
1034429908 7:151036069-151036091 CAGCTCTGCCCCATAGCGCCTGG - Exonic
1035016296 7:155769404-155769426 CAGCTTTGCTCCCAAGGCCAGGG + Intronic
1037942660 8:22964381-22964403 CACCTTTGCCCCACAGAACATGG - Intronic
1038136602 8:24792623-24792645 CAGATTTACTCCAAAGGGCACGG - Intergenic
1038362885 8:26900551-26900573 CAGTTTGTGCCCAAAGAGCAAGG + Intergenic
1039560982 8:38512411-38512433 CACCTGTGCCCCAGAAAGCACGG + Exonic
1039690083 8:39853676-39853698 CAGATGTGACACAAAGAGCATGG - Intergenic
1040628151 8:49175765-49175787 CAGCTTGGCCACAAAGAGTAGGG + Intergenic
1042178252 8:66058918-66058940 GTGCTTTGCCACAAAGAGCTTGG - Intronic
1042416468 8:68526207-68526229 CATCTTGGCCCCAAAGTGCTGGG + Intronic
1042650377 8:71034055-71034077 CTGCTTTGACCCATAGAGTATGG + Intergenic
1044757656 8:95481689-95481711 CAGCTTTGCTCCAAAGCACTTGG + Intergenic
1044930336 8:97246050-97246072 CAGTCTTGTCCTAAAGAGCAGGG - Intergenic
1056052745 9:82786867-82786889 TTCCTTTGGCCCAAAGAGCATGG - Intergenic
1057578883 9:96267857-96267879 TAGGGTTGCCCCACAGAGCAGGG - Intronic
1057693502 9:97307668-97307690 TAACTTTTCCCCGAAGAGCATGG + Exonic
1057852215 9:98574511-98574533 CAGCTGGGCCCCAAACACCATGG + Intronic
1058387042 9:104448831-104448853 CAGTTTTGCCACTTAGAGCAAGG + Intergenic
1059311124 9:113389716-113389738 CAGCTTTGGGCCAAAGGGCCAGG + Intronic
1060018278 9:120106533-120106555 CACCTATCCCCCACAGAGCAAGG + Intergenic
1061903215 9:133683578-133683600 CAGCTTTGCACCACAGAGGCAGG + Intronic
1189279495 X:39811265-39811287 CAGCTCTGGCCCCAAGAGAAAGG + Intergenic
1190298336 X:49041760-49041782 CTGCTCAGCCCCAGAGAGCAAGG + Intronic
1191821492 X:65313898-65313920 CACCTTGGCCTCACAGAGCATGG - Intergenic
1193700723 X:84757354-84757376 GAGCTTTACACCAGAGAGCAGGG - Intergenic
1198087627 X:133295555-133295577 CAGATTAGACCCAAAGAACAGGG - Intergenic
1198262096 X:134974051-134974073 CAGCTCTGCCCCAGTAAGCAAGG - Intergenic
1198372662 X:136006184-136006206 CAGCTTTGCATCAAAGGGGAGGG + Intronic
1199798499 X:151226877-151226899 CAGATTTGACTCAAAGAGGAAGG - Intergenic