ID: 1086096284

View in Genome Browser
Species Human (GRCh38)
Location 11:83053083-83053105
Sequence CCCTGGGCTCCATAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086096277_1086096284 -5 Left 1086096277 11:83053065-83053087 CCCTAACTATCATGAATCCCCTG 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1086096284 11:83053083-83053105 CCCTGGGCTCCATAGATGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 191
1086096276_1086096284 -4 Left 1086096276 11:83053064-83053086 CCCCTAACTATCATGAATCCCCT 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1086096284 11:83053083-83053105 CCCTGGGCTCCATAGATGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 191
1086096275_1086096284 -1 Left 1086096275 11:83053061-83053083 CCTCCCCTAACTATCATGAATCC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1086096284 11:83053083-83053105 CCCTGGGCTCCATAGATGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 191
1086096278_1086096284 -6 Left 1086096278 11:83053066-83053088 CCTAACTATCATGAATCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1086096284 11:83053083-83053105 CCCTGGGCTCCATAGATGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086096284 Original CRISPR CCCTGGGCTCCATAGATGGA AGG Intronic
900607929 1:3531997-3532019 CCCAGGGCCCCATACTTGGAGGG + Intronic
903549392 1:24147314-24147336 CTCTGGGCTCCAAAGTTGGATGG + Intergenic
903554270 1:24181688-24181710 GCCTGGGTTCCTGAGATGGAAGG - Intronic
905158329 1:36007930-36007952 CCCTAGAGTCCACAGATGGACGG + Intronic
911734743 1:101324692-101324714 TCCTGGCCTCCTTAGGTGGATGG + Intergenic
915799817 1:158778530-158778552 ACCTTAGCTCCATAGATGCAGGG + Intergenic
915857464 1:159405051-159405073 CCATGGGCTCCATAGGGTGAGGG + Intergenic
918251786 1:182709496-182709518 CCCTGAGTTCCAAAGATGGTTGG - Intergenic
920092060 1:203461884-203461906 CTCTGGGCTCCACAGGTGGCTGG - Intergenic
920563675 1:206957433-206957455 GTCTGGGCTCCATTGTTGGATGG - Intergenic
921827966 1:219695219-219695241 ACCTGAGCTCCTTACATGGATGG - Intronic
1063287693 10:4708422-4708444 CACTGTGCTCCAGAGATTGATGG + Intergenic
1064323120 10:14324484-14324506 CCCTGGGCCCCATGCCTGGATGG + Intronic
1066460820 10:35610774-35610796 CCCTGGTTTCCATGTATGGAAGG + Intergenic
1067904047 10:50272292-50272314 CACTGGGCTGCATACATGGTAGG - Intergenic
1069621619 10:69840899-69840921 CCCCGGGCGCCAGAGCTGGAAGG + Intronic
1069651306 10:70051998-70052020 GCCAGGGCTCCATGGCTGGAGGG - Intergenic
1070493464 10:76999157-76999179 CCCTGGTCTCCATCAATGGTTGG + Intronic
1070628545 10:78068146-78068168 CCCTCAGCTCCAGAGATGGGAGG - Intergenic
1072201151 10:93160059-93160081 TCGTGTGCTCCAGAGATGGAAGG + Intergenic
1072744948 10:97933354-97933376 CCCTGGGCTCATGAGATCGAGGG - Intronic
1073181645 10:101587348-101587370 CCCTGGGATCCATTGAAGTATGG + Exonic
1073186161 10:101616210-101616232 CCCTAGGCAGCAGAGATGGAAGG - Intronic
1074320156 10:112394285-112394307 CTCTGGGCTCCCTAGGTGAAAGG + Intronic
1075560876 10:123467656-123467678 CCCTGAGCTCCATACATGCAGGG - Intergenic
1075727954 10:124620279-124620301 CCCTGGGCCCCACGGGTGGACGG + Exonic
1077537112 11:3129675-3129697 TCCTGGGACCCTTAGATGGATGG - Intronic
1077995549 11:7449381-7449403 CCCTGAGGTGCATAGATGCATGG + Intronic
1078160282 11:8834045-8834067 CCCTGGGCACCACAGAAAGAAGG + Intronic
1078423973 11:11234403-11234425 CCCAGGGTTCCAGGGATGGAAGG + Intergenic
1079964277 11:26961560-26961582 CCCTGGGCTCTATCAATGGATGG + Intergenic
1081786547 11:45751597-45751619 ACCAGGGCTCCCAAGATGGAGGG + Intergenic
1084675011 11:70629192-70629214 CCCAAGGCTCTCTAGATGGAAGG - Intronic
1086096284 11:83053083-83053105 CCCTGGGCTCCATAGATGGAAGG + Intronic
1087237293 11:95734237-95734259 CCCTGGGCTGCCTAGATAAAGGG + Intergenic
1088841817 11:113633893-113633915 CACTGTGCTCCAGAGATGGCAGG + Intergenic
1089664198 11:120007193-120007215 CCCCTGGCCCCATAGTTGGATGG + Intergenic
1089679192 11:120110000-120110022 TCCTGGGCTCCAGAGATGCCCGG - Intergenic
1091672187 12:2460109-2460131 ACCTGGGCTCCAGAATTGGATGG - Intronic
1091701282 12:2665053-2665075 CCATGAGCTGCAGAGATGGACGG - Intronic
1092590448 12:9948545-9948567 CCCTGGTGTCCATCGATGGGTGG + Intergenic
1094849514 12:34376109-34376131 CCCAGGGCTCCATGCATGCACGG + Intergenic
1094852597 12:34388958-34388980 CCCTGGGCCCCATGCATGCATGG + Intergenic
1094853851 12:34394256-34394278 CCCTAGGCTCCATGCATGCATGG - Intergenic
1094872622 12:34606687-34606709 CCCAGGGCTCCATGCATGCACGG - Intergenic
1095570088 12:43674982-43675004 TCCTGGCCTCCACAGATGGCAGG - Intergenic
1095743615 12:45633460-45633482 CTCTGGGCTCCATCGAGGGAGGG + Intergenic
1097053103 12:56235351-56235373 CCCTGGCCTCCATGGATCTAAGG + Intronic
1101591461 12:106129028-106129050 ACCTGGGCTTCTCAGATGGAGGG + Intronic
1101777190 12:107805994-107806016 CACTGGGCTCCCTAGAAGGCAGG + Intergenic
1104622278 12:130325726-130325748 CCCTGGGCTTGATTGATGAATGG + Intergenic
1104965061 12:132505298-132505320 GCCTGGGCTCCGTGGAAGGAAGG - Intronic
1105781116 13:23705974-23705996 CCCGGGACTCCCTGGATGGATGG + Intergenic
1108981006 13:56514500-56514522 CCCTGGGATCCATCGATTTATGG + Intergenic
1111647716 13:91051645-91051667 CCCTGGTCTCCATAAAAGCAAGG - Intergenic
1113103448 13:106746427-106746449 CCCTGGGCTTCATGGATGTCTGG + Intergenic
1114549438 14:23524544-23524566 CACTGGGCTGCAGAGATGGCAGG + Exonic
1117521430 14:56555106-56555128 ACCTGGGCACCGTAGATCGAGGG - Intronic
1120073324 14:80127277-80127299 CCCTGGCCAGCAAAGATGGAAGG + Intergenic
1121089515 14:91171441-91171463 CCCTGGGCTCCAGGGAGAGATGG + Intronic
1122595438 14:102887209-102887231 CCCTGGGCTCCCTGGATGTGTGG + Intronic
1124239614 15:28018815-28018837 TCCTTAGCTCCAAAGATGGAGGG + Intronic
1127913594 15:63437721-63437743 CCCTTGGCTGGAGAGATGGAAGG + Intergenic
1129042700 15:72703632-72703654 CCCTAGGCCCCATAGAAGGCTGG + Intronic
1130041126 15:80405563-80405585 CCCTGGCCGCCTTAGATGAAAGG - Intronic
1130892595 15:88145727-88145749 CCCTGGCCTCCTGAGATGAAGGG + Intronic
1130899583 15:88197154-88197176 CCCTGGGCACAGTACATGGAAGG + Intronic
1131412975 15:92226423-92226445 CCCTGGGCTCCATGGTGGGTTGG + Intergenic
1132178043 15:99731509-99731531 CCCTGGCCCCCAAAGAGGGAGGG - Intronic
1132849743 16:2019697-2019719 CGCTGGGCTCCCCAGATGGGGGG - Exonic
1137508913 16:49081074-49081096 CTGTGTGCTCCATAGATGGGTGG + Intergenic
1137756250 16:50904698-50904720 CTCTGGTCACCATAGAGGGAGGG + Intergenic
1138585053 16:57964057-57964079 CCCAGGGCTCCCTAGCTGGGAGG + Intronic
1140867825 16:79079420-79079442 ACCTGGGATGCCTAGATGGATGG - Intronic
1141361301 16:83397312-83397334 CCTTGGCTTCCATAGCTGGAAGG - Intronic
1141513635 16:84528473-84528495 CCCTGTGGCCCATATATGGATGG - Intronic
1141748866 16:85945042-85945064 TGCTTGGCTCCATACATGGACGG - Intergenic
1141949318 16:87330540-87330562 GCCTTGGCTCCAAAGCTGGAGGG + Exonic
1143300087 17:5902527-5902549 CCCTGGGTGACAGAGATGGATGG + Intronic
1143568481 17:7739790-7739812 CCCTGGGCACCAAAGAAGCAAGG - Exonic
1143788110 17:9271940-9271962 GCCAGGGCTCCCTAGCTGGAAGG + Intronic
1146466222 17:33088833-33088855 CCCTGGGCTCCCAGGATTGATGG - Intronic
1146659707 17:34657554-34657576 CCCTGGGCCCCACAGATGGTAGG + Intergenic
1150853594 17:68729355-68729377 GCCTGGGTTCCTCAGATGGAAGG + Intergenic
1151654535 17:75489740-75489762 CTCTGGGCTGCAGAGAGGGAGGG - Intronic
1152821384 17:82439478-82439500 CCCTGGGCCCCATGGGTTGAGGG + Intronic
1153773449 18:8433409-8433431 GCCTTGGCTCCACACATGGAAGG + Intergenic
1153791282 18:8582132-8582154 CCTTGGGCTTCATTGGTGGAGGG - Intergenic
1154085547 18:11302050-11302072 CCCTGGGATCCAAGGATGGATGG - Intergenic
1157222862 18:45839806-45839828 CCCTGTGCCCCAGAGAGGGAGGG + Intronic
1159000126 18:62966297-62966319 CCCTGAGCTCCTTAAAGGGAGGG + Intronic
1159131810 18:64288359-64288381 TCCTGGGCTATAGAGATGGAAGG + Intergenic
1161489527 19:4554262-4554284 CCCTGGGGACCAGAAATGGAGGG + Intronic
1165256187 19:34578399-34578421 CTCTGGGGTCCAGAGAAGGAAGG - Intergenic
1165258907 19:34596871-34596893 CTCTGGGGTCCAGAGAGGGAAGG - Intronic
1165266376 19:34665926-34665948 CTCTGGGGTCCAGAGAAGGAAGG + Intronic
1165312855 19:35039444-35039466 GCCTGGGCTCCTGAGTTGGAGGG - Intronic
1165365340 19:35361855-35361877 CCCTGGGCTTCTGAGATGTATGG - Intergenic
1166843700 19:45713451-45713473 CCGGGGGCACCATAGCTGGAAGG + Exonic
1167349012 19:48963476-48963498 CCTTGGGGCCCATAGGTGGAGGG - Intergenic
1168633455 19:57975362-57975384 CCCTAGGCTTCAGAGATGGGAGG + Intergenic
1168644979 19:58053908-58053930 CCCTGGGCTCCATCCCTGGGTGG - Exonic
925918350 2:8623160-8623182 CCCTGGGATCCACAGGTGCAGGG - Intergenic
926433014 2:12808944-12808966 CCGTGGTCTCCATAGATTCAGGG + Intergenic
926686727 2:15704025-15704047 ACCTCTGCTCCATGGATGGAGGG + Intronic
928447681 2:31347507-31347529 CCATGGGCTCCTTACATAGACGG + Exonic
930724598 2:54670424-54670446 CCCTGGGCTCCACAGCTGCGTGG + Intronic
930971213 2:57397726-57397748 CCATGGGCACCATGGATGGCAGG - Intergenic
931694402 2:64860628-64860650 CCCTGAGCTGCATAGCTGGAGGG - Intergenic
933420807 2:82043182-82043204 ACCTGGGCACCATGGATGGCAGG + Intergenic
933845514 2:86323378-86323400 CCCTGGGCTGCAGACAAGGACGG + Intronic
937450030 2:121994260-121994282 CCCTGGGACCCTAAGATGGAAGG - Intergenic
943608759 2:190007371-190007393 CTCTGGGCTCCATAAATCAAGGG + Intronic
947223730 2:227820228-227820250 CCCTGGGTTCTACAAATGGAGGG - Intergenic
948279167 2:236733272-236733294 CCCTGAGCCCCAGGGATGGAAGG + Intergenic
948438326 2:237968337-237968359 GGCTGGGCTCCAAAGATGGTCGG + Intronic
1168794667 20:603493-603515 CTCTGGGCTTCAAAGGTGGACGG + Intergenic
1172107076 20:32523189-32523211 CCCTGGGTCCCATTGATGGGTGG + Intronic
1172881031 20:38200097-38200119 CCCTGGACTCCAGACAGGGAGGG + Intergenic
1174127565 20:48318249-48318271 ACCTGGGCTCAATAGAAGAATGG + Intergenic
1174962441 20:55173818-55173840 CCCCAGGCTCCCTAGATGGCTGG - Intergenic
1176381548 21:6116394-6116416 CCCAGGGCTCCATGGGTGGTGGG + Intronic
1177404303 21:20645743-20645765 CCATGGGCACCATAGATGGCAGG + Intergenic
1178422774 21:32455568-32455590 GCCTGGGATCCAAGGATGGATGG - Intronic
1178724565 21:35039315-35039337 CCCAGGGTTCCATAGCTGGTTGG - Intronic
1179741924 21:43421845-43421867 CCCAGGGCTCCATGGGTGGTGGG - Intronic
1180729584 22:17971643-17971665 TCCTGTGCCCCAGAGATGGAAGG + Intronic
1180949115 22:19713395-19713417 CCGTGGGCTCCCTGGGTGGAGGG - Intergenic
1181439361 22:22927811-22927833 CCCAGGGCTGCACAGATGGTGGG + Intergenic
1181473338 22:23154067-23154089 CCCTGGGCCACTCAGATGGAAGG - Intronic
1181527246 22:23497093-23497115 CCCAGGGCCCCATAGATTGCAGG + Intergenic
1181931850 22:26408264-26408286 CCCTGGGGTCCCCAGAGGGATGG - Intergenic
1182145703 22:27995537-27995559 ACCTGGGCTCCACAGATGTTGGG + Intronic
1182280637 22:29216112-29216134 CCCTGGGCTCCAGGGATGGGAGG + Intronic
1182443254 22:30376286-30376308 CCCTGGGTTCCCTTGCTGGAAGG - Exonic
1182558430 22:31141312-31141334 CCCTGGCCTCACTAGATGGTTGG - Intergenic
1183429186 22:37755477-37755499 CCCTGGGGTCCATAGTGGGGAGG + Intronic
1185160405 22:49224322-49224344 CCCAAGTCTCCATGGATGGATGG + Intergenic
1185289821 22:50017669-50017691 CCCTGGCCTCCATACAGGGTTGG - Intronic
950082764 3:10235126-10235148 CCCAGGGCTCCATCCCTGGATGG + Intronic
950116017 3:10450718-10450740 TCCTGGGCTCCAGAGAGGGACGG - Intronic
951841282 3:27036579-27036601 CCCTGATCTTCAGAGATGGAAGG + Intergenic
954181849 3:48887572-48887594 CCCTGGGCACTAGAGATGTAAGG + Intronic
954423705 3:50432271-50432293 CCCTGGGCTCCACGCATGGAGGG + Intronic
956749643 3:72335732-72335754 CCCTGGGCTCCTTAGGAGGTAGG - Intergenic
958584503 3:96069168-96069190 GCCTGGGCACCATGGATGGCAGG - Intergenic
962392484 3:134984578-134984600 ACCTGGGCCCCAGAGAGGGAAGG + Intronic
962392496 3:134984607-134984629 ACCTGGGCCCCAGAGAGGGAAGG + Intronic
962392508 3:134984636-134984658 ACCTGGGCCCCAGAGAGGGAAGG + Intronic
965904754 3:173689877-173689899 ACATGGGCTCCATAGAAGTAAGG - Intronic
969228772 4:5815666-5815688 CTCTGGTTTCCATAGAGGGAGGG - Intronic
971534873 4:27736189-27736211 CCCTGGGCTCCAGTCATGGGTGG + Intergenic
972372759 4:38440623-38440645 CCCTGGCCTCAATAGAAGAAAGG - Intergenic
973639080 4:52885661-52885683 CACTGGGACCCATAGGTGGAGGG + Intronic
974420124 4:61662606-61662628 CCATGGGCACCATGGATGGCAGG + Intronic
978184059 4:105836495-105836517 CCATGGGCACCATGGATGGCAGG - Intronic
982722405 4:158872066-158872088 CACTGGGCTTCATGGAAGGAAGG - Intronic
984715962 4:182925443-182925465 CCCTGGTCTCCTGAGGTGGAGGG - Intergenic
986345003 5:6826778-6826800 CCAGGGCCTCCAAAGATGGATGG - Intergenic
986569633 5:9151858-9151880 CACTGGGCTCCTGAGAGGGAAGG - Intronic
986694648 5:10340754-10340776 CCCTGGCCTCCTTGGTTGGATGG + Intergenic
987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG + Intronic
991592908 5:68273091-68273113 CCCTGGGCCCCAAAGGTGGGGGG - Intronic
992975119 5:82108833-82108855 CCATTGCCTCCATAGATGTAAGG + Intronic
994612081 5:102055886-102055908 CCCTTGGCTCCCTATATGCATGG - Intergenic
997442600 5:133919212-133919234 CCCTGGGCCACATAACTGGAGGG - Intergenic
1006444001 6:34068776-34068798 CACTGGGCTCCAGACAAGGAAGG + Intronic
1006645707 6:35512757-35512779 CCCTGGGGGGCCTAGATGGAGGG - Intronic
1006943326 6:37767306-37767328 ACCTGGGCTCCACTGTTGGAAGG - Intergenic
1007476614 6:42123752-42123774 CACTGGGCTCGATAGAAGCAGGG - Intronic
1007562195 6:42819120-42819142 CCCTGGAATCCCTAGATGGGTGG - Intronic
1008471379 6:51889064-51889086 CCCTGTGCTACATAGATGAAGGG + Intronic
1015405422 6:132831808-132831830 TCCTGGGCTCCATAAATAGTGGG + Intergenic
1015784226 6:136904374-136904396 CAGTGTGCTCCTTAGATGGATGG + Intronic
1016872166 6:148829136-148829158 CCCTGGGATGGATGGATGGATGG + Intronic
1017806746 6:157952980-157953002 CCCTGGGCTCCAGAACAGGAAGG - Intergenic
1018732675 6:166664275-166664297 CACTGGGCTCAGTAGAAGGAGGG - Intronic
1018968081 6:168504162-168504184 CTCTGGGTTCCTTAGATGGGCGG + Intronic
1019485125 7:1285799-1285821 ACCTGGGCTCCCCAGCTGGAAGG - Intergenic
1019607409 7:1917119-1917141 CCCTGGGGCACATGGATGGAGGG - Intronic
1023754965 7:43407805-43407827 TCCAGGGCTCCATGAATGGAGGG - Intronic
1024912945 7:54466809-54466831 CTCTGGGGCCCATGGATGGAGGG + Intergenic
1027575157 7:79922220-79922242 CTTTGGGCACCATGGATGGAAGG + Intergenic
1030057543 7:105596551-105596573 CACTGGGCTGCATAGGTGAAGGG + Intronic
1035094408 7:156341638-156341660 CCTTGGGCCCCATAGATGTGGGG - Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035367129 7:158356548-158356570 CCCTGTGCTCCACAGATTGCTGG - Intronic
1035876636 8:3196776-3196798 CACTGGTCTCCAGTGATGGAAGG - Intronic
1036735602 8:11312460-11312482 CCTTGGGCTCCATAGATGCTGGG + Intronic
1037909870 8:22737987-22738009 CCCGGGGCTCCAAGGGTGGACGG - Intronic
1038323218 8:26548391-26548413 CCCTGGGCTCAGTATATAGACGG - Intronic
1039565509 8:38549354-38549376 CCCTGGGGTCCATGGGTGGCAGG + Intergenic
1048987854 8:139744958-139744980 CCCTGGCATCCCTGGATGGAGGG - Intronic
1049338767 8:142100705-142100727 TCCTAGGCTCCAGAGCTGGAAGG - Intergenic
1049597379 8:143491081-143491103 GCCTGGGCTCCCTGGAGGGAGGG - Intronic
1053517794 9:38745989-38746011 ACCCGGGCTCCCTACATGGAGGG - Intergenic
1059599829 9:115764955-115764977 CCTTGGGCTCCATACCTAGAGGG + Intergenic
1060043974 9:120325611-120325633 CTCTGGGCTCCATGGGGGGAGGG - Intergenic
1060402716 9:123357595-123357617 ACTTGGGCTCCATAGAGGGGTGG + Intronic
1061434833 9:130554646-130554668 CACTGGGCTCCATTGAGGCAGGG + Intergenic
1062020154 9:134315598-134315620 CCCTGGGCTCCAGAGACTGCTGG + Intergenic
1062207332 9:135344422-135344444 CCCTGGGATCCAGTGCTGGACGG + Exonic
1187441479 X:19324482-19324504 GCCTGGGCTACATAGTGGGATGG + Intergenic
1191105400 X:56769139-56769161 GCCTGGGCTCCAGAGAGGGAGGG - Intergenic
1191106393 X:56774541-56774563 GCCTGGGCTCCAGAGAGGGAGGG - Intergenic
1191107386 X:56779943-56779965 GCCTGGGCTCCAGAGAGGGAGGG - Intergenic
1192206361 X:69099353-69099375 CACTGTGCTCTATGGATGGAAGG + Intergenic
1199815056 X:151389775-151389797 GCCTGTGCTCTATAAATGGAAGG + Intergenic