ID: 1086096332

View in Genome Browser
Species Human (GRCh38)
Location 11:83053561-83053583
Sequence ACTCAAGGGTCCAGAGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086096332 Original CRISPR ACTCAAGGGTCCAGAGTTAT TGG (reversed) Intronic
901038363 1:6349712-6349734 CCTCCAGGGCCCAGAGGTATGGG + Intronic
902951292 1:19884798-19884820 ACTCAAGGGACCGGAGATGTGGG - Intronic
906775866 1:48529019-48529041 CCTCAAGGGTTCAGGGTTTTTGG + Intergenic
907594929 1:55711100-55711122 ACTCAAAATTACAGAGTTATGGG - Intergenic
909308094 1:74107146-74107168 ACTTTAGGTTCCATAGTTATGGG + Intronic
911437250 1:97876955-97876977 AGTGAAGGGCCCAGAGATATTGG + Intronic
913504571 1:119504809-119504831 AAACAAAGGTCCAGAGTGATTGG - Intergenic
917237406 1:172909320-172909342 ACTCAAGAATCCAGACTTTTTGG + Intergenic
918389684 1:184045896-184045918 ACTCAGGGCTTCAGAGTTAATGG - Intergenic
920915481 1:210254758-210254780 ACTCAAGGTCACAAAGTTATAGG - Intergenic
921804312 1:219436612-219436634 ACTTAAGGGTCCAGACTTAAGGG - Intergenic
923925158 1:238618681-238618703 ACTCAAAGATCCACTGTTATTGG + Intergenic
1064846329 10:19658558-19658580 AAGTAAGGGTCAAGAGTTATTGG + Intronic
1068797306 10:61097753-61097775 CCTCAAGAGCCCAGAGATATTGG - Intergenic
1072517692 10:96202144-96202166 AATGAAGGGACCAGATTTATAGG + Intronic
1073632138 10:105159770-105159792 ACTCCAGGGACCAGAGCTTTGGG - Intronic
1077635214 11:3837474-3837496 ACACAAGGGCCCAGAGTGAGGGG + Intronic
1079387449 11:19993277-19993299 ACTCTGGGATCCAGAGTTAGAGG + Intronic
1082030163 11:47597957-47597979 AGCCAATGGTCCAGAGTTAGGGG + Intergenic
1083529697 11:63408668-63408690 ACTCAAAGGGCAAGAGCTATGGG + Exonic
1083966961 11:66049056-66049078 AGACAAGGGTCCAGAGATAGCGG - Exonic
1086096332 11:83053561-83053583 ACTCAAGGGTCCAGAGTTATTGG - Intronic
1090155062 11:124428562-124428584 ACTCCAGGGTCCTCAGTTTTGGG - Intergenic
1099858198 12:88196466-88196488 ACTCAAAAGTTTAGAGTTATTGG - Exonic
1106250956 13:27981163-27981185 ACTCAAGGGTCCAGTGGTTTGGG - Intronic
1109427593 13:62186733-62186755 ACTCAAGGATTCAGAGATATAGG + Intergenic
1110581407 13:77133742-77133764 AATCAAATGTTCAGAGTTATGGG - Intronic
1111135644 13:84039144-84039166 AGTCATGTGTCCAGAGTTGTAGG + Intergenic
1115726168 14:36218315-36218337 CTTTAAGGGTCCAGAGTTGTGGG - Intergenic
1117530063 14:56652167-56652189 ACTCAAGGATCCAGGGTAATGGG - Intronic
1119175134 14:72563163-72563185 TCTCAAGGGTCCAGCGTTCGAGG + Intronic
1120460945 14:84794098-84794120 ACTCAAGAGTCTAGAATTCTGGG - Intergenic
1121722175 14:96117049-96117071 ACTCAAGGGCCAAGATTTTTTGG - Intergenic
1124208042 15:27739932-27739954 ACTCAGGGGTGCAGAGGTACAGG + Intergenic
1127053547 15:55109636-55109658 ACTCAAGGGTCAAGGACTATAGG - Intergenic
1131371726 15:91887427-91887449 CCTCAAGGGTGCAGGGTTAGCGG - Intronic
1132392363 15:101448431-101448453 ACAAAAGGGTACAGAGTTAGTGG + Intronic
1136607260 16:31344740-31344762 AGTCAGGGGACCAGAGTGATTGG - Intergenic
1136924732 16:34361719-34361741 ACTCAATAGTGCAGAGTTAGGGG - Intergenic
1136979841 16:35050087-35050109 ACTCAATAGTGCAGAGTTAGGGG + Intergenic
1140144568 16:72294105-72294127 AGTCAAGTCTCCAGACTTATTGG - Intergenic
1142268302 16:89075542-89075564 AATCAAGGGTGCAGAGTTGTTGG - Intergenic
1150479727 17:65499899-65499921 ATTCAAGGCTCCTGAGATATTGG - Intergenic
1154308437 18:13247853-13247875 ACTAAAGGCTCCAGAGTGAGCGG - Intronic
1158249463 18:55470693-55470715 ACTCTAGGGTCCTGGGTGATTGG - Intronic
1158289298 18:55920722-55920744 AGTCAACTGTCCAGAGTGATGGG - Intergenic
1158809008 18:61009300-61009322 ACTCAAGGTTCTAGAGTGCTGGG + Intergenic
1163431882 19:17273138-17273160 GCTCAAGGGCTCAGAGTAATGGG + Intronic
928233526 2:29520747-29520769 AATCATGGGTCCAGAGAAATGGG + Intronic
928251753 2:29686927-29686949 GCTCAAGGGTCCAGATCTAAGGG + Intronic
929325313 2:40603365-40603387 ACAGAAGGGTACAGAGTAATGGG + Intronic
929581025 2:43081990-43082012 ACTCAGGAGTCCAGAGTTGGTGG + Intergenic
932573857 2:72952067-72952089 ACTCAGGGGTCCAGGGGTCTAGG - Intronic
939161228 2:138592153-138592175 ACTAAAGTATTCAGAGTTATTGG - Intergenic
939299599 2:140318625-140318647 ATTCTAGCTTCCAGAGTTATTGG - Intronic
943596905 2:189869100-189869122 GCTCAAGGGGACACAGTTATTGG + Intronic
947005813 2:225509710-225509732 TCTGTAGAGTCCAGAGTTATAGG + Intronic
947496604 2:230642323-230642345 ACTCAAAGGTCCTGGGTCATGGG + Intergenic
948296073 2:236861586-236861608 ACTCTAGGGACCTGAGTTAGGGG + Intergenic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1179383463 21:40920637-40920659 TTTCAAGGGTCCAGTGGTATTGG + Intergenic
1180891548 22:19292089-19292111 ACTCAACCGTCCAGAGTTGGCGG - Intergenic
1183345910 22:37307549-37307571 GCTCAGGGGTCCAGAGTCAGGGG - Intronic
1185237874 22:49725192-49725214 AGTCAAAGGTCCTGATTTATCGG + Intergenic
957641831 3:82862902-82862924 ACTCAAGAGAACAGAGTTAGGGG + Intergenic
961240239 3:125404435-125404457 AATCAAGGGGCCATTGTTATTGG + Intergenic
964735407 3:159912097-159912119 ACTCAGGAGTCCAGATTTATAGG - Intergenic
964764230 3:160162871-160162893 ACTCAAAGGTCAAGACCTATTGG + Intergenic
968948729 4:3679246-3679268 CCGGAAGGGTCCGGAGTTATGGG + Intergenic
971126631 4:23761750-23761772 ATTCATGGGTCCAGAATCATGGG + Intronic
975287849 4:72641094-72641116 ACTCAAGGGGCCAAAGGTAATGG + Intergenic
978275510 4:106944795-106944817 ACTCTAGAGACCAGAGTAATTGG + Intronic
979724213 4:123941595-123941617 GCTCAAGGGTCAAGAGTTAAAGG - Intergenic
980025811 4:127765123-127765145 ACACAAGGCTCCAGATTTAACGG - Intronic
981589168 4:146338631-146338653 ACTCTTGGGTGCAGAGTTAGTGG + Intronic
981644691 4:146985613-146985635 CCTGAAGAGTCCAGAGTTGTAGG + Intergenic
983291572 4:165813726-165813748 TCTCAAGAGACCAGAGTTAGTGG + Intergenic
986024802 5:3840833-3840855 CCTCAAGGTTCCAGGATTATAGG - Intergenic
986063257 5:4211766-4211788 ACTCAAGGAACAAGACTTATTGG - Intergenic
989437713 5:41434126-41434148 CCACAAGGATCCACAGTTATTGG - Intronic
1001741845 5:174059638-174059660 ACTCTGGGATCCACAGTTATAGG - Intronic
1004105652 6:12665348-12665370 ACTCCAGGGTCAGGAGTCATGGG + Intergenic
1005431612 6:25763701-25763723 ACTCAAGGTTTCTGGGTTATTGG - Intronic
1007236485 6:40394180-40394202 TCACAAGGGTCCAGAGTTCAGGG - Intronic
1010126894 6:72442921-72442943 ACTCTAGGGTGCATAGTTGTAGG + Intergenic
1010805192 6:80227620-80227642 ACTCAAGTATACAGATTTATAGG - Intronic
1010914552 6:81599757-81599779 ACTCAAGGGCCCAGGCTTATGGG - Intronic
1011603996 6:89084234-89084256 TCTCAAGAGTCCAGGGATATGGG - Exonic
1012304161 6:97629558-97629580 ATTCAAGGTTCCAGAGGTAAAGG - Intergenic
1012836861 6:104280456-104280478 TCTCAAGGATGAAGAGTTATAGG - Intergenic
1013220283 6:108071985-108072007 ACTCTAGGGTGCAGTATTATGGG - Intronic
1021628262 7:22616149-22616171 AGTCAAGGCTCTAGAGTTTTGGG + Intronic
1021778018 7:24072970-24072992 ACTCAAGGGTACTCAGTTACTGG + Intergenic
1024914714 7:54486377-54486399 TCCCTAGGGACCAGAGTTATGGG - Intergenic
1026026781 7:66751873-66751895 ACTCAAGGGCCCAGTGAAATAGG - Intronic
1027154892 7:75760010-75760032 ACTTAAAGGTCCAGAGTTGAGGG + Intergenic
1032676318 7:134133052-134133074 ACTCCAGGATGCAGAGTTGTGGG + Intronic
1036086183 8:5615710-5615732 ACTCAAGGGACCAGAAAGATTGG + Intergenic
1045765819 8:105666873-105666895 ACTCAAGGGTTTAGATTTAGTGG - Intronic
1047327275 8:123851874-123851896 ACTCATGGGTCCAGAGATCAAGG - Intergenic
1049332342 8:142061361-142061383 ACTCCAGCCTCCAGAGTTGTGGG + Intergenic
1056530188 9:87479846-87479868 ACTCATGGCTCCAGAGTCCTGGG - Intergenic
1061631290 9:131873941-131873963 ACTCAAGGGTCCAGGGAGTTGGG - Intronic
1186101078 X:6157314-6157336 ACCCAAGGGTAAAGAGTTAATGG + Intronic
1189562951 X:42209673-42209695 ACTCAGGGTTCCAGAGTAGTCGG - Intergenic
1195158932 X:102152624-102152646 ACTGAAGGTTCCAGAGAAATCGG + Intergenic
1196497613 X:116340155-116340177 ACTTAAGGGTACAGAGTGAGAGG + Intergenic
1198868579 X:141152244-141152266 ACACAAGGGTGCAGAGTCACAGG - Intergenic