ID: 1086098126

View in Genome Browser
Species Human (GRCh38)
Location 11:83071053-83071075
Sequence CGAAGGTTCTTTCAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086098126_1086098130 4 Left 1086098126 11:83071053-83071075 CCAGCAGCCTGAAAGAACCTTCG 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1086098130 11:83071080-83071102 ACACGTGAAATGTTTCTGACTGG 0: 1
1: 0
2: 0
3: 4
4: 93
1086098126_1086098131 9 Left 1086098126 11:83071053-83071075 CCAGCAGCCTGAAAGAACCTTCG 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1086098131 11:83071085-83071107 TGAAATGTTTCTGACTGGCACGG 0: 1
1: 0
2: 2
3: 17
4: 232
1086098126_1086098132 25 Left 1086098126 11:83071053-83071075 CCAGCAGCCTGAAAGAACCTTCG 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1086098132 11:83071101-83071123 GGCACGGAGTGCACCATTAAAGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086098126 Original CRISPR CGAAGGTTCTTTCAGGCTGC TGG (reversed) Intronic
903690704 1:25171460-25171482 GGAAGGGTGTTTCAGGCTGTGGG - Intergenic
905584847 1:39108150-39108172 CAAAGGTTCTTTCAGATAGCTGG + Intronic
909699096 1:78500518-78500540 CGAAGGTCCATTCATGCTTCAGG + Intronic
917833022 1:178913861-178913883 CCAAGGTGCTCCCAGGCTGCTGG + Intronic
921546284 1:216478551-216478573 TGAAGGTTATTTCAGACTTCCGG + Intergenic
922062310 1:222104298-222104320 CAAAGGTCCTTGCCGGCTGCTGG - Intergenic
1063035385 10:2281631-2281653 CGTAGGTCCTCTCAGGGTGCAGG + Intergenic
1063122470 10:3114649-3114671 GGAAGGTGCTCCCAGGCTGCTGG + Intronic
1067786643 10:49255052-49255074 CCAGGGTCCTTTCAGCCTGCAGG + Intergenic
1068173922 10:53431788-53431810 CAAAGGTCCTCTCAGGCTGATGG - Intergenic
1068378270 10:56213100-56213122 GCAGGGTTCTTTCAGGCTGGTGG + Intergenic
1070086363 10:73241028-73241050 AGAAGAATCTATCAGGCTGCAGG + Exonic
1073827032 10:107336284-107336306 AGCAAGTTCTTTCAGGCTCCAGG + Intergenic
1075782147 10:125023966-125023988 CGAAGATGCGTTCAGGCTGGCGG + Intronic
1076719386 10:132386619-132386641 GGAAGGTGCTTACAGGCTGGTGG + Intergenic
1076851050 10:133093184-133093206 GGAAGATTCCTTCAGGCAGCTGG + Intronic
1078454112 11:11461876-11461898 TGCAGCTTCATTCAGGCTGCAGG - Intronic
1079008629 11:16810489-16810511 CCAAGCCTCTTCCAGGCTGCTGG + Intronic
1086098126 11:83071053-83071075 CGAAGGTTCTTTCAGGCTGCTGG - Intronic
1088500065 11:110474187-110474209 AGAAGGTGCCTTCATGCTGCAGG + Intergenic
1088615581 11:111624076-111624098 GGAAGGTTGTTTCAGGCTGGAGG + Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1100464767 12:94835145-94835167 CCAAGGTCCTCTGAGGCTGCAGG + Intergenic
1104891389 12:132141828-132141850 CGTAGGTTGTGTCAGGGTGCGGG - Exonic
1108677998 13:52754503-52754525 CGAAGGTTCTTACAGGCTCAGGG - Intergenic
1113848752 13:113406241-113406263 AGAAGGTTTTGTGAGGCTGCAGG + Intergenic
1120768290 14:88352039-88352061 CTATGGTTCTTCCAGGCTGTTGG + Intergenic
1122101185 14:99411179-99411201 AGAAGGTTTATTCAGGATGCTGG - Intronic
1126486633 15:49188288-49188310 AGAACTTACTTTCAGGCTGCTGG + Intronic
1129354092 15:74976329-74976351 CCATGGCTCTTTCAGCCTGCAGG + Intronic
1129940736 15:79494840-79494862 CGAAGATTGTGTCAGGGTGCAGG + Intergenic
1130686836 15:86045369-86045391 CTATGGTTCTCTCTGGCTGCAGG - Intergenic
1132601837 16:776243-776265 CGGGGCTCCTTTCAGGCTGCAGG - Intronic
1133088505 16:3384667-3384689 TGAATGCTCTTTCAGGCTCCTGG - Exonic
1134215014 16:12310651-12310673 CAAAGGTTCCTTCAGACTCCTGG - Intronic
1139004142 16:62550602-62550624 GGAACTTTCTTTCAGGCTGTTGG - Intergenic
1140990493 16:80206528-80206550 GGAAGGTTCTCTCTGGCTGTGGG - Intergenic
1141561920 16:84874789-84874811 CGATGGTTATCTCTGGCTGCTGG - Intronic
1142432018 16:90034105-90034127 CTAAGGTTCTTCCTGGCTGCTGG + Intronic
1148061881 17:44842440-44842462 CAAAGGTACTTTCTGGCTTCAGG + Intergenic
1160237018 18:77093790-77093812 TGAGCGTGCTTTCAGGCTGCTGG - Intronic
1160432929 18:78824696-78824718 CAAAGGTGCTTTAAGGGTGCGGG + Intergenic
927132420 2:20071766-20071788 TGAAATTTCTTTCTGGCTGCAGG + Intergenic
927840761 2:26441823-26441845 TGAAGGGTTTTTCAGGCTGAGGG - Intronic
928478387 2:31654856-31654878 CGAAGGCTCTTTCTTGCTACAGG + Intergenic
931831847 2:66060850-66060872 ACAAGGGTCTTTCTGGCTGCAGG + Intergenic
932420315 2:71597561-71597583 GGAAGGTTCATTCAGGCTGCTGG - Intronic
939863926 2:147451374-147451396 AAAAGATTCTTTCACGCTGCAGG + Intergenic
948718183 2:239879744-239879766 CGCAGCTTCCTCCAGGCTGCAGG + Intergenic
1170246296 20:14225040-14225062 GGAAGTTTCTTTCAGGTTGTAGG + Intronic
1179192894 21:39138295-39138317 CAAAGGTTCTTTGCTGCTGCTGG - Intergenic
1179598162 21:42457295-42457317 CGAAGATATTTTCAGGCTGACGG + Intergenic
1179822386 21:43944250-43944272 CGATGGCTATTTCAGGCTCCAGG + Intronic
1181665877 22:24396587-24396609 TGAAAGTTCTTTGAGGCTGGGGG - Intronic
949362819 3:3249744-3249766 CCAGGGTTCTTTCAGTCTCCCGG - Intergenic
953536232 3:43778889-43778911 CCCAGGTTCTTTCTGGCTGTTGG - Intergenic
960387316 3:117035861-117035883 TGAAGCATCTTGCAGGCTGCAGG + Intronic
961329652 3:126131037-126131059 CGCAGGTCCTTCCTGGCTGCAGG - Intronic
963924127 3:150933475-150933497 GGAAGATTATTTCAGGCTGAAGG + Intronic
965297654 3:166969867-166969889 GGAAAGTCCTTTCAGGCTCCAGG + Intergenic
967687312 3:192432710-192432732 TGCAAGTTCTTTCGGGCTGCTGG - Intronic
968397383 4:254718-254740 CGTATGTTCATTCAGGCTTCTGG - Intergenic
970129365 4:12850035-12850057 AGAAGATTCTTTCAGTCTCCAGG - Intergenic
971268550 4:25115663-25115685 CCAAAGGTCTTTCAGGATGCTGG - Intergenic
971347557 4:25825489-25825511 CGGTGATTCTTTCAGGCTTCTGG - Intronic
973310723 4:48706834-48706856 CTCAGGTTCTTTCTGGCTGTTGG - Intronic
973728565 4:53801195-53801217 GCAAGGTACTTTCAGGCTGGAGG - Intronic
981128597 4:141133321-141133343 CGCCGGTTCCCTCAGGCTGCGGG + Intronic
984434659 4:179693966-179693988 CAAAGGTCTTTTCAGGCTGGTGG - Intergenic
987082993 5:14442343-14442365 AGAAGGGTCTTTCGGGGTGCAGG + Intronic
990661983 5:58026190-58026212 AGAAAGTTCTTTAAGTCTGCAGG - Intergenic
997500905 5:134372195-134372217 CCAAGGTCCTTTCAGGCGGGCGG - Intronic
1001649238 5:173303696-173303718 GGAAGGTTCGTTCAAGCTGGAGG + Intergenic
1003890359 6:10558689-10558711 GGTAGGTGCTCTCAGGCTGCAGG + Intronic
1009287318 6:61836549-61836571 CAAAGGATTTTTCATGCTGCAGG - Intronic
1013026025 6:106272511-106272533 TGAAAGTTGTTTCAGGCTGAGGG - Intronic
1015373279 6:132480374-132480396 CCAAGTTTCTTTCTGGCTGTAGG - Intronic
1019146414 6:169978091-169978113 AGAAGGTGCCTTCATGCTGCAGG - Intergenic
1021377722 7:19929253-19929275 GGAAGGTTCTCTCAAGCTGCAGG + Intergenic
1028571301 7:92290412-92290434 AGAAAGTTCATTCAGGCAGCAGG - Intronic
1029411770 7:100417273-100417295 GGTAGGCTCTTTCAGGCTACAGG - Intronic
1037974850 8:23201762-23201784 TGTGGGTTCTTTGAGGCTGCTGG + Intronic
1039397924 8:37243230-37243252 CCAAGGTTCGTTGAGGCTGTGGG + Intergenic
1045400991 8:101817707-101817729 CAATGCATCTTTCAGGCTGCTGG - Intronic
1053102467 9:35382319-35382341 TGAAGAGTCTTTGAGGCTGCGGG + Intronic
1056874847 9:90318408-90318430 CTAAGGTCCTTACTGGCTGCTGG + Intergenic
1186349905 X:8731045-8731067 CGTAGGTTCTTTCAGCCTGAGGG - Intronic
1189255044 X:39631409-39631431 AGAAGCATATTTCAGGCTGCTGG - Intergenic
1194365655 X:93010859-93010881 CCAATGTGCTTTCAGACTGCTGG + Intergenic
1196084618 X:111671877-111671899 GGATGCTCCTTTCAGGCTGCTGG + Intronic