ID: 1086105180

View in Genome Browser
Species Human (GRCh38)
Location 11:83139711-83139733
Sequence TGAAAGAGCCTCTGTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086105179_1086105180 -9 Left 1086105179 11:83139697-83139719 CCATTCTTAGATCTTGAAAGAGC No data
Right 1086105180 11:83139711-83139733 TGAAAGAGCCTCTGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086105180 Original CRISPR TGAAAGAGCCTCTGTGAAGC TGG Intergenic
No off target data available for this crispr