ID: 1086110332

View in Genome Browser
Species Human (GRCh38)
Location 11:83192341-83192363
Sequence CCTTTTAAGCAATTTGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086110332_1086110340 13 Left 1086110332 11:83192341-83192363 CCCGCCACAAATTGCTTAAAAGG No data
Right 1086110340 11:83192377-83192399 TGTTCCGGGCTCAGACTTTCTGG No data
1086110332_1086110336 -2 Left 1086110332 11:83192341-83192363 CCCGCCACAAATTGCTTAAAAGG No data
Right 1086110336 11:83192362-83192384 GGTGATTGATCCCTTTGTTCCGG No data
1086110332_1086110337 -1 Left 1086110332 11:83192341-83192363 CCCGCCACAAATTGCTTAAAAGG No data
Right 1086110337 11:83192363-83192385 GTGATTGATCCCTTTGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086110332 Original CRISPR CCTTTTAAGCAATTTGTGGC GGG (reversed) Intergenic
No off target data available for this crispr