ID: 1086111179

View in Genome Browser
Species Human (GRCh38)
Location 11:83200098-83200120
Sequence GGGTGATTTTGGAGAGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086111170_1086111179 27 Left 1086111170 11:83200048-83200070 CCTAGTTTCATCTAGTTGGAGTT 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1086111179 11:83200098-83200120 GGGTGATTTTGGAGAGAAGGGGG 0: 1
1: 0
2: 4
3: 46
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086111179 Original CRISPR GGGTGATTTTGGAGAGAAGG GGG Intronic
900149029 1:1170263-1170285 CGGTGCTTATGGAGAGGAGGAGG - Intergenic
901132709 1:6972155-6972177 GGGTTATTGTGCAGAGAAGGGGG + Intronic
901952789 1:12761883-12761905 GAGTGATTTGGGAGAGAGGGTGG + Exonic
902243159 1:15101994-15102016 GGGGGTTGTTGGAAAGAAGGAGG - Intronic
902547570 1:17199544-17199566 GGGTGATCCTGGAGAGCAAGTGG + Intergenic
903443937 1:23408675-23408697 TGGTCTTTTTGGAGAGGAGGAGG + Exonic
904335422 1:29794131-29794153 GGGTGTCCTGGGAGAGAAGGAGG - Intergenic
905593664 1:39187092-39187114 GTGTGACTTTGGGAAGAAGGGGG - Intronic
906679569 1:47716611-47716633 GGGGGATATCGGAAAGAAGGAGG - Intergenic
907077710 1:51593443-51593465 GGGTGAGGCTGGAGAGCAGGTGG - Intronic
907207103 1:52782739-52782761 GGCTAATTTTGTAGAGACGGGGG + Intronic
907393659 1:54174972-54174994 GGCTTGTTTTGGAGATAAGGAGG - Intronic
908789750 1:67769957-67769979 GGATGATATGGGAGGGAAGGAGG + Intronic
908885440 1:68782799-68782821 GGGAGGTTTTGGAGATATGGAGG - Intergenic
909050013 1:70755110-70755132 GGGTGACTTTGAATAGAATGGGG - Intergenic
909845588 1:80389661-80389683 GGGTGATTTTGGTGAGAGATAGG - Intergenic
910200177 1:84690665-84690687 GGGTTTTTTTGGAGGTAAGGAGG - Intronic
911102289 1:94104414-94104436 GGGAGAATTTGGAGAGGAAGAGG - Intronic
911122873 1:94313339-94313361 GGGTGATTGTGGGGAGAAAGAGG - Intergenic
914802449 1:150971522-150971544 GTGTGATTTGGGGGAGGAGGAGG - Intronic
916071492 1:161172706-161172728 GGGGGATGTGGGAGAGAAGCTGG - Intronic
916618658 1:166472113-166472135 GGGTTATTTTGAAGAGACAGAGG + Intergenic
917114114 1:171584709-171584731 GGGTGATGGTGGTGAGAAGGGGG - Intronic
917168288 1:172138968-172138990 TGGTGATTTTGGAGAGTAAGGGG + Intronic
917808432 1:178635057-178635079 GGGTGGCTTGGGAGAGAAGACGG - Intergenic
918691667 1:187488178-187488200 GGGAGATCTGGGAGAGAAAGGGG - Intergenic
919483635 1:198119778-198119800 AGGTGGTTATGGAGAGAAGGAGG - Intergenic
919505774 1:198396136-198396158 GGGATGTTTTTGAGAGAAGGTGG + Intergenic
919693268 1:200546595-200546617 GGGTGACTGGGGAGAGAAGGAGG + Intergenic
919784678 1:201251729-201251751 GGGTGCTCTGGGAGAGAAGGAGG + Intergenic
919815596 1:201436638-201436660 GAGAGAGCTTGGAGAGAAGGCGG + Intergenic
919915061 1:202133997-202134019 GGGGCAGTCTGGAGAGAAGGAGG - Exonic
920137022 1:203778242-203778264 GGGTGCTTCTAGAGGGAAGGAGG - Intergenic
920932777 1:210404450-210404472 TTTTGATTTTGTAGAGAAGGTGG + Exonic
922895270 1:229095158-229095180 GCTTGATTTTGCAGAGAATGTGG + Intergenic
923513210 1:234671568-234671590 GGGTAATCATGGAAAGAAGGAGG - Intergenic
923573575 1:235138657-235138679 GGTTGCCTTTGGAGGGAAGGAGG - Intronic
923826949 1:237510938-237510960 GGGTGATTTGTGAGATCAGGAGG + Intronic
924702628 1:246469184-246469206 GAGTGATTGTGGAAAGCAGGTGG - Intronic
1063083400 10:2790110-2790132 GTGTGGTTTTGGAGGGATGGTGG - Intergenic
1063166301 10:3465916-3465938 GGGTGATTTTTCAGGGAACGTGG + Intergenic
1063323449 10:5073975-5073997 GGGTGACTTTGAATAGAATGGGG - Intronic
1063869722 10:10404525-10404547 GGGTGATTTTTGAGAGAGAGTGG + Intergenic
1064103464 10:12482282-12482304 GGGTGGTTCTGGAGGGAATGAGG + Intronic
1064648949 10:17488889-17488911 GGGTAATTTTGGAGCAAATGTGG - Intergenic
1065037892 10:21659343-21659365 TGGTCATTCTGGAGAGAAGAAGG - Intronic
1065223708 10:23521647-23521669 GGGTGGCTGTGGGGAGAAGGAGG + Intergenic
1067771773 10:49131730-49131752 AGGAGATGCTGGAGAGAAGGCGG - Exonic
1068518746 10:58055988-58056010 GGCTGATTGAGGAGAGAAAGGGG + Intergenic
1069291649 10:66787421-66787443 GGGTGAGGTTGGACAGAAGTTGG + Intronic
1069789195 10:71008822-71008844 GGGTGTTTTTGGAAAGAGAGAGG + Intergenic
1069872411 10:71541154-71541176 GGATTATTAGGGAGAGAAGGGGG - Intronic
1069919859 10:71810025-71810047 CAGTGATGTTGGAGAGCAGGTGG - Exonic
1070684497 10:78470963-78470985 GGGTGGTTTTGTAGAGGATGTGG - Intergenic
1070856697 10:79612385-79612407 TGGAGAGTGTGGAGAGAAGGGGG + Exonic
1071223389 10:83496400-83496422 GGCTGATTTTGGAGGGAAATTGG + Intergenic
1071803784 10:89094157-89094179 GGGTGAGTTTGGAAAGGATGTGG + Intergenic
1072188881 10:93064953-93064975 AGGTGATTTTGGAAGGAAGAAGG - Intronic
1072265227 10:93720812-93720834 CGTTGATTTTGGGAAGAAGGGGG + Intergenic
1073229554 10:101957235-101957257 TGGTTATTTGGGATAGAAGGAGG - Intronic
1074028807 10:109663996-109664018 GGGAGATGATGGAGAGATGGTGG + Intergenic
1074247462 10:111709277-111709299 GGGGGATTTGGAAGGGAAGGAGG + Intergenic
1075031738 10:119029102-119029124 TGCTGATGTTGGTGAGAAGGGGG + Intergenic
1075441408 10:122481953-122481975 GGGTGATTTACAAAAGAAGGAGG - Intronic
1075624300 10:123950770-123950792 GGTTGAGGTTGGAGAAAAGGAGG + Intergenic
1075685554 10:124362955-124362977 GGTTGTTTTTGTAGAGAGGGGGG + Intergenic
1075848156 10:125563819-125563841 TGCTGATTTTGAAGAGAAGTTGG - Intergenic
1075921976 10:126221081-126221103 GGTAGATTTAGAAGAGAAGGAGG + Intronic
1076054847 10:127364080-127364102 GGGTGTTTGTGGAGTGCAGGGGG + Intronic
1076464524 10:130669418-130669440 GGCAGCTTTTGGAGAGAAGAAGG + Intergenic
1077332336 11:1989137-1989159 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1078258729 11:9683939-9683961 GGGTCAGGTTGGTGAGAAGGTGG + Intronic
1080533093 11:33195843-33195865 GGAAGATTTTGTAGAGAAGGTGG + Intergenic
1080621135 11:33988074-33988096 GGGGAGTTTTGCAGAGAAGGAGG - Intergenic
1080747701 11:35123494-35123516 TGGTGAGTTTGGAGATAAAGTGG + Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1082801907 11:57421144-57421166 GGGTGAGTTTGGGTATAAGGAGG - Intronic
1083251075 11:61467607-61467629 GGCTAATTTTGCAGAGATGGGGG + Intronic
1084588315 11:70076278-70076300 GGGTGCTGTTGGGGAGAAGGTGG + Intergenic
1084720700 11:70903904-70903926 GGGGCATTTCGGGGAGAAGGAGG - Intronic
1084779011 11:71396659-71396681 GGGTGAATTTGGAGAGGACCAGG + Intergenic
1085415731 11:76318120-76318142 GGGTGATTCAGCAGAGAAGATGG + Intergenic
1085649667 11:78256373-78256395 GGGTGATTGTGGAAAGGAAGGGG + Intronic
1085649741 11:78257060-78257082 GGGTGATTGTGGAAAGGAAGGGG - Intronic
1085861314 11:80239265-80239287 GGGTGGTGAGGGAGAGAAGGAGG + Intergenic
1086111179 11:83200098-83200120 GGGTGATTTTGGAGAGAAGGGGG + Intronic
1086330246 11:85746752-85746774 GGGTGATTTTGAAAAGCAAGAGG + Intronic
1087115480 11:94520258-94520280 AAGTGTTTTTAGAGAGAAGGAGG - Intergenic
1089577675 11:119458158-119458180 GGGGGATTGTGGGGAGAATGGGG + Intergenic
1090412849 11:126520873-126520895 GGCTGATTCTACAGAGAAGGTGG + Intronic
1202815318 11_KI270721v1_random:44313-44335 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1092263615 12:6965113-6965135 GGGTGATGTGGGAGAAATGGAGG + Intergenic
1093093246 12:14944330-14944352 GGGTGGCATTGGAGGGAAGGGGG - Intronic
1094052630 12:26237941-26237963 GTGTGATTGTAGAGAGCAGGAGG + Intronic
1094473304 12:30822961-30822983 GGGTGAGTTCGCAGAGACGGCGG - Intergenic
1094627385 12:32136758-32136780 GAGTGAGTTTCGAGAGTAGGGGG + Intronic
1095823780 12:46509774-46509796 GGGTGACTTTGAATAGAATGGGG - Intergenic
1095856709 12:46867611-46867633 GGGTGACTTTGAATAGAATGAGG + Intergenic
1096848537 12:54420852-54420874 GGGTGATTTGGGACAGGAAGTGG - Intergenic
1097283412 12:57859941-57859963 GGGTGATTTTTGAGAGGAGAAGG + Intergenic
1097400427 12:59121962-59121984 GGTTCCTTTTGGAGGGAAGGAGG - Intergenic
1097550974 12:61068603-61068625 GGATGAATTTGAAGAGAAGAAGG - Intergenic
1098015774 12:66103202-66103224 GAGTGCTTGTGGAGAGAAGAAGG + Intergenic
1098190078 12:67938623-67938645 GGGTGAGAGTAGAGAGAAGGGGG + Intergenic
1099015481 12:77338922-77338944 GGGTGAGTTTGGAGGGAAAAAGG + Intergenic
1101554230 12:105792715-105792737 GGTTATTTTTGGAGAGAGGGAGG + Intergenic
1103405629 12:120673101-120673123 GGTTGCTTTTAGAGAGAAGGAGG + Intergenic
1103603849 12:122072152-122072174 GGGTGATTTAGGAGCAAAAGGGG - Intergenic
1103927292 12:124429922-124429944 GGGTGTTTTAGGAGAGAGGAAGG - Intronic
1104318054 12:127722568-127722590 GAGAGAATTTTGAGAGAAGGCGG + Intergenic
1105843227 13:24273219-24273241 GGCTGAGTTTTGAGAGCAGGAGG + Intronic
1106101597 13:26698139-26698161 GGCTGGCTTTGGAGAGAAGAGGG - Intergenic
1106906312 13:34413302-34413324 GAGGTATTTTGGGGAGAAGGGGG - Intergenic
1106923467 13:34588974-34588996 GGGTCAGTTTGGAGACGAGGGGG - Intergenic
1110995613 13:82104192-82104214 TCATGATTTTAGAGAGAAGGTGG + Intergenic
1111025751 13:82520338-82520360 GAGTTATTTTGGAGAGAAAATGG + Intergenic
1111601739 13:90482756-90482778 GGGTGATTTTAAAAAGAAAGAGG + Intergenic
1111729314 13:92052924-92052946 GGGGTGTTTAGGAGAGAAGGTGG - Intronic
1111876073 13:93897730-93897752 GGGTGATTTTTAACAGATGGGGG - Intronic
1113545117 13:111142776-111142798 GGCTCATTTTGGAGAGGAGATGG - Intronic
1114318806 14:21529773-21529795 GGTTGCTTTTGCAGAGATGGGGG - Intronic
1114867800 14:26619059-26619081 GGATGATTTTTGTGAGAAGTTGG + Intergenic
1116388729 14:44365381-44365403 GGTTTATTCTGGAGAGTAGGAGG - Intergenic
1116776943 14:49192284-49192306 TATTGATTTTGGAGAGCAGGGGG - Intergenic
1116940644 14:50787632-50787654 GGGTGATATTGAAAAGAAAGTGG - Intronic
1117339995 14:54784500-54784522 GGGTTATGTTGGTGACAAGGAGG - Intronic
1118904470 14:70013645-70013667 GGAAGATTTTTGACAGAAGGCGG - Intronic
1118970691 14:70634916-70634938 GAGTGAGTGTGGAGAGAAAGGGG + Intergenic
1118979989 14:70708598-70708620 GGGAGATGATGGAGAGAGGGAGG + Intergenic
1119437408 14:74606347-74606369 GGATGGTTGTGGAGACAAGGTGG - Intronic
1119903153 14:78278459-78278481 GGGTGGTTTTTGGGTGAAGGTGG + Intronic
1121439889 14:93941969-93941991 GAGTGAGGTTGGACAGAAGGTGG + Intronic
1121519502 14:94576444-94576466 GGGTGATCTGGGTGGGAAGGTGG - Intronic
1122430903 14:101642563-101642585 GGGTTCTTTTGGAGAGAAGGGGG + Intergenic
1122871752 14:104641965-104641987 GGGTGAGTGAGGAGTGAAGGTGG + Intergenic
1124929632 15:34106675-34106697 GGGTGACTAGGGAGAGAAGTAGG - Exonic
1125721296 15:41846386-41846408 GGAGGACTTTGGAGAGAAGCAGG - Intronic
1126684901 15:51240073-51240095 GGGTCATTCTGCGGAGAAGGGGG - Intronic
1128261112 15:66233687-66233709 GAGTCATGTTGGAGAGAAGTGGG - Intronic
1129665744 15:77578533-77578555 TGGGGATTTTGGAGGGGAGGGGG - Intergenic
1129919013 15:79302573-79302595 GGGTAATTCTTGGGAGAAGGGGG + Intergenic
1130168892 15:81491513-81491535 CGGTGGTATTAGAGAGAAGGTGG + Intergenic
1130821030 15:87495943-87495965 GCTTGATTTTGGAGGGTAGGTGG - Intergenic
1131065614 15:89433401-89433423 GGGTGCATTTGGAGGGAGGGAGG - Intergenic
1131383061 15:91980466-91980488 GGGTGATAGAGGGGAGAAGGGGG + Intronic
1131904949 15:97133107-97133129 GTGTGTGTTTGGAGAGATGGTGG + Intergenic
1132078526 15:98844634-98844656 GTGTGTATTTAGAGAGAAGGAGG + Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1133397920 16:5463156-5463178 GGTTGAGTTTGGAGAGTAGTAGG + Intergenic
1133569288 16:7025629-7025651 GGGGGGTTTTGGATAGAGGGGGG + Intronic
1134832877 16:17337691-17337713 GGGCAAGTTTGGAGAGAAGAAGG - Intronic
1134884923 16:17781986-17782008 GGGTGATGTTGGGAAGAAGAAGG - Intergenic
1135850256 16:25957040-25957062 GGGTGGATCTGGAGACAAGGAGG + Intronic
1136453281 16:30366630-30366652 GGGTGATTTCAGGGAGGAGGAGG - Intronic
1137863211 16:51867815-51867837 TGGTGAATTTGGAGAGTAGAAGG - Intergenic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1141205007 16:81926731-81926753 TTGTGAATTTAGAGAGAAGGTGG - Intronic
1142290869 16:89193110-89193132 GGGTGGTGTTGGGGAGGAGGCGG - Intronic
1142425764 16:90001493-90001515 GGGTGTTTGTGGAGAGACTGTGG + Intergenic
1143141435 17:4743837-4743859 GGGTGTTTTTGGTGAGCTGGAGG + Exonic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143501693 17:7343122-7343144 GAGTGAGATGGGAGAGAAGGGGG + Intronic
1143980536 17:10865564-10865586 GGAAGATTTTGCAGAGGAGGTGG + Intergenic
1145941623 17:28745866-28745888 GAGTGGTTTTGGAGAAAGGGAGG - Intronic
1146179254 17:30686878-30686900 GGGTGATTCTGGGGAGACAGAGG + Intergenic
1146438764 17:32876336-32876358 GGATTATTTTGGAGAGAGGCTGG - Intronic
1149218604 17:54388849-54388871 GGCTGTTTTTGAATAGAAGGTGG - Intergenic
1149218849 17:54390718-54390740 GGCTGTTTTTGGATTGAAGGTGG + Intergenic
1149680912 17:58506679-58506701 GGGTGGCTTTGGTGAGGAGGGGG - Intronic
1150266478 17:63835377-63835399 GGGAGGTTCTGGAGGGAAGGAGG - Intronic
1150554803 17:66244760-66244782 GGGTGACTTTGAATAGAATGGGG - Intronic
1150629798 17:66871402-66871424 GGGTTTAATTGGAGAGAAGGAGG - Intronic
1151922509 17:77168081-77168103 GCGTGATTTGTAAGAGAAGGAGG + Intronic
1152356850 17:79811665-79811687 TTGAGATTTTGAAGAGAAGGAGG - Intergenic
1152450666 17:80377482-80377504 GGGTACTTTTGGAGGCAAGGTGG - Intronic
1152600037 17:81257708-81257730 CGGTGATGTGGGACAGAAGGAGG - Intronic
1153788455 18:8555919-8555941 GGGTTATTAGGGAGTGAAGGGGG - Intergenic
1154307071 18:13238529-13238551 GGGTTATTTTGGAGAGCAGGTGG + Intronic
1154465591 18:14640996-14641018 GGGCGTTTTTGGGGAGATGGAGG - Intergenic
1156905587 18:42348550-42348572 GCTTGACTTTGGAGAGAAGACGG + Intergenic
1157571410 18:48714771-48714793 GGGTGAGTGAGGAGAGGAGGTGG - Intronic
1158571502 18:58600444-58600466 GGGTGATTATGTATAGAAAGAGG + Intronic
1158697554 18:59716317-59716339 GGGGGATCTTGGTGAGCAGGTGG + Intergenic
1158849641 18:61482525-61482547 TAGTGTTTCTGGAGAGAAGGTGG - Intronic
1159236324 18:65678837-65678859 GGGTGATTTTGGAGACTTGGTGG + Intergenic
1159602653 18:70443316-70443338 GTGTGATTTGTAAGAGAAGGAGG + Intergenic
1159811547 18:73023600-73023622 GGGTGACTTTGAATAGAATGGGG - Intergenic
1159915180 18:74182293-74182315 AGGTGATATTGAAGAGCAGGAGG - Intergenic
1162049037 19:8021051-8021073 GGAGGGTTCTGGAGAGAAGGAGG + Intronic
1162485842 19:10960421-10960443 GGGAAGTTTTGCAGAGAAGGCGG + Intergenic
1162718858 19:12649909-12649931 GGGAGATCCTGGAGAGGAGGTGG - Exonic
1162979370 19:14228691-14228713 GGGTGATTCTGGGGAGACAGAGG - Intergenic
1163023220 19:14495017-14495039 GTGTTGCTTTGGAGAGAAGGAGG + Intronic
1163621537 19:18363729-18363751 CGGAGCTTTTGTAGAGAAGGAGG - Exonic
1166058723 19:40311062-40311084 AGGTTTTTTTGTAGAGAAGGGGG - Intergenic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166485283 19:43206750-43206772 GTGTGCTTGTGGGGAGAAGGGGG - Intronic
1166890281 19:45987571-45987593 GGGTGAGGATGGAGAGGAGGTGG - Intergenic
1167483747 19:49748127-49748149 GCGAGAATCTGGAGAGAAGGCGG - Exonic
1167664545 19:50816509-50816531 GGGTGACTTTGGAGAGGACTGGG + Intergenic
1167701201 19:51047129-51047151 TGTGGATTTTGGAGAGTAGGAGG - Intergenic
1168520686 19:57048088-57048110 GGGTGAGATGGTAGAGAAGGTGG - Intergenic
1168523552 19:57071355-57071377 GGGTGATTCTGCAGTGAGGGAGG + Intergenic
926152476 2:10432729-10432751 GGGTGATGCTGGAGACACGGTGG + Intergenic
926173428 2:10568711-10568733 TGGTGGCTTTGGAGAGAGGGGGG - Intergenic
926313044 2:11688288-11688310 GGGTGACTGTGGGGAGAGGGAGG - Intronic
926380927 2:12288443-12288465 GGTTAATGTTGGAGGGAAGGAGG + Intergenic
927060346 2:19412805-19412827 GGTTGAGGTTGGAGGGAAGGTGG - Intergenic
927558276 2:24050590-24050612 GGATCACTTAGGAGAGAAGGTGG - Intronic
927784658 2:25965299-25965321 GGGTGAGACTGGGGAGAAGGAGG - Intronic
928043118 2:27898369-27898391 GGGTGAGCTTGGAGAAAAGAAGG + Intronic
929054473 2:37863824-37863846 AGGAGCTTTTGGAGAGAATGCGG - Intergenic
929469662 2:42178962-42178984 GGGATATTTTGGTGAGAAGCAGG + Intronic
929541782 2:42828507-42828529 GGGTTTTTTTGTAGAGAAGGGGG - Intergenic
931686464 2:64798191-64798213 GTGTGTTTTTAGAGAAAAGGTGG + Intergenic
931842921 2:66173438-66173460 GGGTGAGGTGGGAGGGAAGGGGG + Intergenic
932608990 2:73184642-73184664 GGGTGAAGTTAGAGAGAAAGAGG + Intergenic
932659648 2:73641274-73641296 GGCTGAGTCTGAAGAGAAGGTGG - Exonic
932666211 2:73700951-73700973 GGGTGAATCTGAAGAGAAGGTGG - Intergenic
932791397 2:74656807-74656829 GGGTGAGTTGGGAGACATGGGGG + Intronic
934063886 2:88321709-88321731 GGGGGATTTTGAGGAGGAGGAGG - Intergenic
934721354 2:96579088-96579110 TGGTGCTTTTGAAGAGAAGGTGG - Intergenic
934886174 2:98027359-98027381 GGGTGATTTCTCAGAGAAGAGGG + Intergenic
935152753 2:100452779-100452801 GGGTGACTTTGAATAGAATGGGG - Intergenic
935309714 2:101771548-101771570 GGTTCCTTTTGGAGAGAAGGGGG + Intronic
936888576 2:117342065-117342087 TGGTGTTTTAGGATAGAAGGAGG - Intergenic
937092447 2:119215564-119215586 GTGTGTTTTTGTAGAGATGGGGG + Intergenic
937109169 2:119349626-119349648 GAGGGATTTTGGAGAGAAGCTGG - Intronic
937693138 2:124778916-124778938 AGGTGATTTTGTAGAAGAGGAGG + Intronic
937886358 2:126902186-126902208 GGATGATTCTGGAGAGGAGTGGG - Intergenic
937975374 2:127579136-127579158 GGGAGATGTCAGAGAGAAGGTGG + Intronic
939895998 2:147791966-147791988 GGGAGAGATTGGAGACAAGGAGG - Intergenic
940875307 2:158892193-158892215 AGGTGAATATTGAGAGAAGGAGG - Intergenic
943141371 2:183986814-183986836 GGGAGATTTTGGAGAAATGGTGG - Intergenic
946177010 2:217928298-217928320 GAGGGATCCTGGAGAGAAGGTGG + Intronic
947148550 2:227090577-227090599 TTGTGATTTTGCAGAGATGGGGG - Intronic
948493937 2:238333171-238333193 CTGTCATTTTGGGGAGAAGGGGG + Intronic
1168916042 20:1489178-1489200 TGGTTGTTTTGGAGACAAGGAGG + Intronic
1169024687 20:2359336-2359358 TGGTGAGTTTGTAGAGAAAGGGG - Intergenic
1170825674 20:19792774-19792796 GGGTGATTTGAGGGAGGAGGGGG + Intergenic
1171139970 20:22732763-22732785 GGGGACTTTTGGGGAGAAGGAGG - Intergenic
1172483620 20:35286065-35286087 GGGAGGTTTTGGACAGAGGGAGG - Exonic
1172962776 20:38810223-38810245 GGATGTTTTTGGAGAGCAGTGGG + Intronic
1173788613 20:45813005-45813027 GGGTGAGATTCGAGAGATGGGGG + Intronic
1173825103 20:46043183-46043205 GCGTGATTGTGGAGAGGAGTGGG + Exonic
1174139656 20:48404042-48404064 AGGTGATTTGGAAGACAAGGGGG + Intergenic
1174713448 20:52731356-52731378 GAGGGATTCTGGAGAGAAAGAGG - Intergenic
1175768773 20:61609547-61609569 GGGACCTCTTGGAGAGAAGGTGG + Intronic
1175812069 20:61863818-61863840 GGGTGACTTTGGAGGCCAGGTGG - Intronic
1178614815 21:34123339-34123361 GGGTGATTTTAAAGTGCAGGAGG - Intronic
1178896927 21:36566780-36566802 GGGTGAATTTGGAGGGAAAGTGG - Intronic
1179442573 21:41405669-41405691 AGGTGATGTAGCAGAGAAGGGGG - Intronic
1180023331 21:45143248-45143270 GTCTGAGTTTGGAGAGCAGGGGG - Intronic
1180121115 21:45748859-45748881 TGGTGATCTGGGAGAGAAGCAGG - Intronic
1181731188 22:24848054-24848076 GGGTGATATGGAAGAGAAGATGG - Intronic
1182517958 22:30869756-30869778 GGCAGAGTTTGGACAGAAGGTGG + Intronic
1183320835 22:37164212-37164234 GGGTACTTTTGGAGAGGTGGAGG - Intronic
1183530499 22:38350931-38350953 TGGTGATGATGGAGAGGAGGAGG + Intronic
1183953500 22:41365897-41365919 GGGTCATTAGGGAGGGAAGGAGG + Intergenic
1185214336 22:49589889-49589911 GGGTGAGTTTGGGGACAAAGAGG - Intronic
949208682 3:1472061-1472083 GGGTGATTCTGTAGAACAGGAGG - Intergenic
949753354 3:7379909-7379931 GGGTGATGATGAAGGGAAGGCGG - Intronic
950294327 3:11815271-11815293 GGGTGATAATGAAGGGAAGGTGG + Intronic
950476582 3:13218903-13218925 GGGTGATTTGGGAGAGTTTGAGG - Intergenic
950589647 3:13927528-13927550 GGGTGCTTTTGGAGAAAGGTTGG - Intergenic
950662237 3:14473614-14473636 AGGGGATTTGGCAGAGAAGGGGG + Intronic
951206779 3:19933961-19933983 GGATGATTTAGGAGACAAGAGGG - Exonic
952421215 3:33132777-33132799 GGGTTATTTTGGAAATAAAGGGG + Intronic
952851597 3:37734146-37734168 GGGTGAATGTGGACAGAATGAGG - Intronic
953224376 3:41002860-41002882 GGCTGATTTTGGAGATGAAGGGG - Intergenic
953289626 3:41648773-41648795 TGGTGATGTTGGAGAGCAAGTGG - Intronic
953390537 3:42531383-42531405 GAGAGATTTTGGAGAAAAGCAGG - Intronic
954982022 3:54754879-54754901 GGGGCATTTTGGAGAGAGGGGGG + Intronic
955053345 3:55433487-55433509 GGGGGCTATTGGAGGGAAGGAGG + Intergenic
955113306 3:55971794-55971816 GGGTGATTTTGGCTATGAGGAGG - Intronic
955977723 3:64494190-64494212 GGGTGATGTTGGAGAAAGGTGGG - Intergenic
956903839 3:73744859-73744881 AGGTGCTTTTGGAGAGATGTTGG - Intergenic
957482706 3:80819027-80819049 TGGTGAGTTTGCAGAGAAAGGGG + Intergenic
958643701 3:96841299-96841321 GGGTGACTTTGAACAGAATGCGG + Intronic
958924623 3:100144514-100144536 GGGTGATGTTGGAGACAAACTGG - Intronic
958978795 3:100696975-100696997 GGGTGGTGTGGCAGAGAAGGAGG + Intergenic
959579214 3:107967068-107967090 GGGATATTTTGGAGGGAAGAAGG + Intergenic
959914312 3:111798916-111798938 GGGTGATTTATGAAAGAAAGAGG + Intronic
960684212 3:120280698-120280720 GTGTGAGTAAGGAGAGAAGGTGG - Intronic
960686968 3:120304768-120304790 GGGTGAAATTAGAGAGCAGGAGG + Intergenic
962061300 3:131930363-131930385 GGGTGACCTTGCAGAGAAAGGGG + Intronic
962325821 3:134431306-134431328 AGATGCTTTTGAAGAGAAGGTGG + Intergenic
962339346 3:134568878-134568900 GGGTGATTTACAAGAGAAAGAGG + Intronic
963765617 3:149333170-149333192 TGGAGACTTGGGAGAGAAGGGGG - Intronic
964764148 3:160162319-160162341 GGGAGAAGTTGGAGAGAAGATGG + Intergenic
965196613 3:165605488-165605510 GGGTTTTTTTGGGGGGAAGGGGG - Intergenic
965219657 3:165912426-165912448 GGGGGATTTTAAAGAGAAAGAGG - Intergenic
967870358 3:194224243-194224265 GGGTGTTTGTGCAGAGGAGGTGG - Intergenic
968059631 3:195717443-195717465 GGGTGATTTTGAATAGAATGGGG - Intergenic
968293675 3:197556981-197557003 GGGTGATTTTGAGTAGAATGGGG - Intronic
969133553 4:5011321-5011343 GGGTGGATTTGGAGGGAGGGAGG + Intergenic
969267126 4:6071792-6071814 GGGTGATTATGAAGAGACGGGGG - Intronic
971092773 4:23363917-23363939 TGCCGATTTTGCAGAGAAGGTGG + Intergenic
971364327 4:25965418-25965440 GGGTGATTTTTGAGAAAAGAAGG + Intergenic
972204615 4:36757362-36757384 TGGTGTGTCTGGAGAGAAGGAGG - Intergenic
972614817 4:40687755-40687777 GGGTTAGTTTGGAAGGAAGGAGG - Intergenic
972970049 4:44563430-44563452 AGGTCATTTTGAGGAGAAGGTGG - Intergenic
973730412 4:53817148-53817170 GGGAGAGATTGGAGATAAGGTGG - Intronic
974626924 4:64437728-64437750 GGGTGATATTTGGGAGCAGGAGG - Intergenic
975814285 4:78201829-78201851 GTGTGAGTTGGGAGAAAAGGGGG + Intronic
975892532 4:79046696-79046718 AGGTCTTTTTGGAGAAAAGGAGG - Intergenic
976169811 4:82291586-82291608 GTTTGATTTTGCAGAGATGGAGG - Intergenic
976213274 4:82692724-82692746 GGGTGGTTTTTGAGAGGAAGTGG - Intronic
976425225 4:84895522-84895544 GGGTGAATATGGAGAAAAGCTGG + Intronic
977354175 4:95925017-95925039 GGGTGAATTTGAATAGAATGGGG - Intergenic
977672844 4:99716011-99716033 GGGAAATTTTGGGCAGAAGGGGG + Intergenic
978289380 4:107119225-107119247 GGGTGATTTTCCTGAGAAGGTGG - Intronic
978701588 4:111653072-111653094 TGGTGACTTTGAAGAGAATGTGG + Intergenic
980062471 4:128146618-128146640 TGGTTTTTCTGGAGAGAAGGAGG + Intronic
980988381 4:139717604-139717626 AGGTGTTTTTGGAGAGGAGGCGG - Exonic
981877019 4:149559090-149559112 GGTTGTATTTGGAGATAAGGAGG - Intergenic
981965738 4:150600571-150600593 GGGTGATTTTGGTCAGGAGAAGG + Intronic
982203610 4:152980974-152980996 GGGTGATTTTGCAGAGACCCCGG - Intergenic
983292732 4:165826508-165826530 TGGGGTTTTGGGAGAGAAGGCGG - Intergenic
984704902 4:182840470-182840492 GGGTGATTCTGGTGAGAAGCTGG - Intergenic
984865674 4:184278231-184278253 GAATGAGTTTGGAGTGAAGGGGG - Intergenic
985904582 5:2823396-2823418 GGGTGATCAAGAAGAGAAGGCGG + Intergenic
986228384 5:5838708-5838730 GGGAGATTTTGGAGAAAATGTGG + Intergenic
986349570 5:6865425-6865447 GGTGGATTGAGGAGAGAAGGAGG - Intergenic
986364044 5:7011802-7011824 GGGTGATTTTTGAAGGAAAGAGG + Intergenic
986456292 5:7923900-7923922 GTTTTATTTTGGAGAGCAGGTGG + Intergenic
987520884 5:18981875-18981897 TGGTGATGTTGAAGAGAAAGGGG - Intergenic
989330486 5:40252428-40252450 TGGTGAGGTTGCAGAGAAGGGGG - Intergenic
989770143 5:45135177-45135199 GGTTGTTTTTTGAGAGAATGGGG - Intergenic
989841358 5:46075866-46075888 GGGATATTTTGGAGAGCATGAGG + Intergenic
990057551 5:51603145-51603167 GGGTGTGTTTTGAGAGCAGGTGG - Intergenic
990248779 5:53891644-53891666 GGGTGATCTGGGGGAGAATGGGG - Intronic
991417610 5:66408207-66408229 GGAGGATTTCAGAGAGAAGGAGG - Intergenic
991593123 5:68275050-68275072 AGGTTTTTTTGGAGAAAAGGAGG + Intronic
994788648 5:104195937-104195959 TGGTAATTTTGGAGAGTAAGTGG + Intergenic
996108308 5:119533601-119533623 GGGAGGTTTGGGAGAGAAGAAGG + Intronic
998387422 5:141765773-141765795 GGGTGAGATTGGAGAGCAGGAGG - Intergenic
998796690 5:145827586-145827608 GGGTCATTTTTGAAAGAAAGAGG - Intronic
999363511 5:151006216-151006238 GGGTGGGTTTGGAGAGCAGGAGG - Intergenic
999671975 5:153966083-153966105 GGGAGATGATGGAGAGAAGAGGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001581001 5:172798426-172798448 GGATAATTTTCGGGAGAAGGTGG + Intergenic
1003116708 6:3288265-3288287 GGGTGTTTGGGGAGAGAAGGGGG - Intronic
1003569706 6:7247854-7247876 AGGTTATTTTGGAAAGAAGAAGG - Intronic
1003822746 6:9918162-9918184 GGAAGATATTGGAGAGAATGTGG - Intronic
1004446056 6:15699769-15699791 GGGTGCATTTGGAAAGAAGCGGG + Intergenic
1004630681 6:17418156-17418178 GAGAGAGTTTGGAGAGAAGGCGG + Intronic
1004655796 6:17659043-17659065 GGGTGTTGTTGTAGAGAAGTAGG - Intronic
1004705687 6:18122102-18122124 GCATCAGTTTGGAGAGAAGGGGG - Exonic
1005512900 6:26528088-26528110 GAGTGTTTTAGGAGAGAAAGAGG - Intergenic
1006420180 6:33928385-33928407 GGGTGACTTTAGGGAGAGGGTGG - Intergenic
1006489631 6:34376147-34376169 GGTTGGTTTCGGAGAGAAGATGG - Intronic
1006566575 6:34963264-34963286 GGGTGATGTTGGGGAGATGTTGG - Intronic
1006651875 6:35558244-35558266 AGGTTTTTTTGGAGAGATGGGGG - Intergenic
1007278507 6:40693061-40693083 GGGTGGTGTTAGAGAGCAGGAGG - Intergenic
1007400149 6:41598713-41598735 GGGTGAGTTTGGGGGGCAGGGGG + Intronic
1007534484 6:42573489-42573511 GAGTCATTTTGCAGGGAAGGAGG + Intronic
1007770245 6:44186321-44186343 TGGTGATAATGGAGGGAAGGCGG - Intergenic
1007970603 6:46048544-46048566 AGGTGAGTTTTGAGAAAAGGAGG - Intronic
1008264905 6:49413025-49413047 GGCAGATTTTTGAGAGGAGGTGG + Intergenic
1008269026 6:49467810-49467832 GGAAGATTTTGAAAAGAAGGTGG + Intronic
1008324782 6:50165032-50165054 GAGTGATTAGGGAGAGACGGAGG - Intergenic
1009935237 6:70225989-70226011 AGGTGACTTGGGAGAAAAGGGGG - Exonic
1010615843 6:78011089-78011111 GGGTTATTTTTAAGAGAAGACGG - Intergenic
1011135618 6:84096837-84096859 GGGTAATTCTTGAGAGAAGAAGG + Intergenic
1011270804 6:85578092-85578114 TGGTGATATAGGAGAAAAGGAGG + Intronic
1011676555 6:89740233-89740255 GGGTGACTTTGGAAAAAAGGAGG - Exonic
1013728368 6:113130032-113130054 TGGTGATGATGGAGAGTAGGAGG + Intergenic
1013758564 6:113489181-113489203 GGGTTATATTGAAAAGAAGGTGG - Intergenic
1013805521 6:113992119-113992141 GGGTCAGTTTGCAGAGAAAGGGG + Intronic
1014748929 6:125232966-125232988 GGGTGACTTTGGGGTAAAGGAGG + Intronic
1014992229 6:128094988-128095010 AGGTGAGTTTGAAGGGAAGGTGG + Intronic
1016271376 6:142294010-142294032 GAGTGATGTTCTAGAGAAGGGGG - Intergenic
1017245480 6:152219728-152219750 TGATGATTTTGGTGAGCAGGGGG + Intronic
1017556784 6:155580215-155580237 GGGTGGTCTTTGTGAGAAGGTGG + Intergenic
1017754591 6:157518634-157518656 GGGTGAGTTGGGAGGGAGGGTGG - Intronic
1017775751 6:157679476-157679498 GGGTCATAGAGGAGAGAAGGGGG - Intergenic
1018369620 6:163155941-163155963 GGATGAATTTGGAGAAAAGAGGG - Intronic
1018699716 6:166416720-166416742 AGGTGATTGTGGAGGGATGGTGG - Intronic
1019770361 7:2880554-2880576 GGGCGATGATGGAGAGAAAGGGG + Intergenic
1020564576 7:9778980-9779002 GCTTGACTTTGGAGAGAAGATGG - Intergenic
1021028233 7:15696428-15696450 GTGTTATTTGGGAGAAAAGGTGG - Intergenic
1021128018 7:16876608-16876630 GGGAGATAATGGAGAGAATGAGG - Intronic
1021280256 7:18708274-18708296 GGGTGGTTATGGAGAAAAAGAGG + Intronic
1021539321 7:21739456-21739478 GAGTGATTATGAAGATAAGGAGG + Intronic
1022790178 7:33680615-33680637 GGGTAATTTTGGAGAAAATAAGG + Intergenic
1023622704 7:42089001-42089023 GGGTTACTTTGTAGAGAGGGAGG - Intronic
1023838265 7:44080923-44080945 GAGGGAGTTGGGAGAGAAGGAGG + Intronic
1023929435 7:44696338-44696360 ACGTGATTTTGGGGAGAAGCAGG - Intronic
1024049743 7:45610922-45610944 AGGTGATTTTGGAGGTGAGGAGG + Intronic
1024139848 7:46451262-46451284 TGGTGACTTTGGAGTGAAGATGG + Intergenic
1024585214 7:50836115-50836137 GGGTGAGGTAGGAGAGAACGAGG - Intergenic
1024616937 7:51123825-51123847 GGGTGATGTGGGTGAGGAGGTGG - Intronic
1024855579 7:53774745-53774767 TGGTGATTTTTAAGGGAAGGAGG - Intergenic
1026744493 7:73000514-73000536 AAGTGAGTTTGGAGAGAGGGTGG - Intergenic
1027030599 7:74885179-74885201 AAGTGAGTTTGGAGAGAGGGTGG - Intergenic
1027099244 7:75364578-75364600 AAGTGAGTTTGGAGAGAGGGTGG + Intergenic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1027587972 7:80081632-80081654 GGGAGATGTTGGAAAGAAAGAGG + Intergenic
1027795793 7:82691602-82691624 GGCTGATTTTGGATTGAAGGTGG + Intergenic
1028451663 7:90991801-90991823 TGGTGATGCTGGAGTGAAGGTGG + Intronic
1028548632 7:92031517-92031539 TGGTGAATTTGGAGTGAAAGAGG + Exonic
1029277054 7:99412346-99412368 GGGTGACTTTTGAGGGAAGGAGG + Intronic
1029378491 7:100197101-100197123 AAGTGAGTTTGGAGAGAGGGTGG + Intronic
1030482942 7:110127096-110127118 GGATGATACTGAAGAGAAGGTGG + Intergenic
1030848457 7:114453459-114453481 TTTTGCTTTTGGAGAGAAGGTGG - Intronic
1031190308 7:118540647-118540669 GGGTCATGTTGGAGAGGATGAGG + Intergenic
1031273471 7:119686208-119686230 GAATTATTTTGGAGAGAATGCGG - Intergenic
1031462612 7:122070060-122070082 GAGTAATTCTGGAGAGAGGGAGG + Intergenic
1032728708 7:134616304-134616326 GAGTGAAGTTAGAGAGAAGGTGG + Intergenic
1034476761 7:151289236-151289258 GGATGACTTTGCAGAGAACGTGG + Intergenic
1035019430 7:155792034-155792056 GAGGGATTATGGAGAGAGGGTGG - Intergenic
1035019435 7:155792053-155792075 GGGGGATTACGGAGAGAGGGAGG - Intergenic
1035230670 7:157463857-157463879 GGGTGAGTGTGGACAGATGGGGG - Intergenic
1035230679 7:157463888-157463910 GGGTGAGTGTGGACAGATGGGGG - Intergenic
1035230700 7:157463946-157463968 GGGTGAGTGTGGACAGATGGGGG - Intergenic
1035230709 7:157463977-157463999 GGGTGAGTGTGGACAGATGGGGG - Intergenic
1035427965 7:158794609-158794631 GGGAGTTTTTGTAGAGATGGGGG - Intronic
1036148319 8:6275156-6275178 GGGTGAATGTGGACAGGAGGTGG + Intergenic
1036174631 8:6525265-6525287 ATGTAATTTTGGAGAGATGGGGG + Intronic
1037472262 8:19222450-19222472 TGGTGAAATTGGAGAGGAGGAGG + Intergenic
1039280147 8:35975959-35975981 GGGTGAGTTTGGAGAGGAAAAGG - Intergenic
1039383055 8:37103579-37103601 GGGAGATTTTGCAAAGAAGGGGG - Intergenic
1039816068 8:41095548-41095570 AAGAGATTTTGGAGAGAACGTGG - Intergenic
1040060688 8:43100551-43100573 GGGTGCTTATGGAGGGGAGGTGG + Intronic
1040313701 8:46249916-46249938 GGGGGATTTTGGAAAGGAAGAGG - Intergenic
1040733076 8:50473359-50473381 GGGTGATTTTTAAGGGAAAGAGG - Intronic
1041010037 8:53532674-53532696 GGAAGTTTTTGGAGAGTAGGGGG - Intergenic
1041465648 8:58155335-58155357 GGGTGAGAGTGGAGAGAATGGGG - Intronic
1042042562 8:64608577-64608599 GGGTGATCTTAAAGAGAAGGTGG + Intronic
1042093613 8:65187516-65187538 GGGAGATTTATGGGAGAAGGAGG - Intergenic
1043508390 8:80925020-80925042 GGGAGAATTGGCAGAGAAGGAGG + Intergenic
1043664189 8:82787197-82787219 GGGAGAATTTACAGAGAAGGTGG + Intergenic
1044419307 8:91974509-91974531 TTGTGATTTTGGACAGAAGAAGG - Intronic
1045113817 8:98960279-98960301 GGGTACCTTTGGAGAGAAAGAGG + Intergenic
1046471223 8:114676839-114676861 AGGTAATTTTGGAGACAAAGGGG - Intergenic
1047714915 8:127586635-127586657 GGGTGATTGGGGAAAGCAGGTGG - Intergenic
1047946042 8:129881500-129881522 TGCTGATGTTGGAGAGTAGGTGG - Intronic
1048958155 8:139554038-139554060 GGGTGAAGTTGGTGAGAATGAGG - Intergenic
1049136912 8:140910771-140910793 AGATGGTTTTGGAGAGAATGGGG - Intronic
1049417539 8:142502126-142502148 GGGTGATTATGGAGTGGTGGTGG + Intronic
1049529492 8:143147277-143147299 GAATGTGTTTGGAGAGAAGGGGG + Intergenic
1049529497 8:143147302-143147324 GCATGAGTTTGGAGAGAAGGGGG + Intergenic
1049529501 8:143147327-143147349 GGATGAGTTTGGAGAGAAGGAGG + Intergenic
1049529507 8:143147352-143147374 GGATGTGTTTGGAGAGAAGGGGG + Intergenic
1049529513 8:143147377-143147399 GGATGAGTTTGGAGAGAAGGGGG + Intergenic
1049529519 8:143147402-143147424 GGATGTGTTTGGAGAGAAGGGGG + Intergenic
1049716752 8:144096513-144096535 GGGTGGTGCTGGAGAGATGGGGG + Intronic
1050820917 9:9878869-9878891 GTTTGATTGTGGAGGGAAGGAGG - Intronic
1051942951 9:22530756-22530778 AGGTGGTTTAGGAGAGGAGGTGG - Intergenic
1052704276 9:31975572-31975594 AGGTAATTTTGGAAAGAATGTGG + Intergenic
1052774289 9:32718443-32718465 AGGTGATTTGGGAGGGAAAGCGG - Intergenic
1053139653 9:35674585-35674607 GGATGAGATGGGAGAGAAGGGGG + Intronic
1055206162 9:73733091-73733113 TTGTGAGTTTGGAGAAAAGGTGG - Intergenic
1055260918 9:74432624-74432646 GGGGCATTTTGGGCAGAAGGTGG + Intergenic
1055509041 9:76976414-76976436 GTCTGATTTTGGAGATAAAGAGG - Intergenic
1055610843 9:78022243-78022265 GGGTGAGTTTGGGCAGAAAGTGG + Intronic
1056506493 9:87263169-87263191 GGCTGATTTTGCAGAGGAGATGG + Intergenic
1056697266 9:88870601-88870623 AGGTGCTTTTGCACAGAAGGAGG - Intergenic
1056924099 9:90818199-90818221 GGGTCATTTCAGAGAGGAGGGGG + Intronic
1057813826 9:98279269-98279291 GGGTGACTTGTGAGAGAAAGTGG + Intergenic
1058384309 9:104415620-104415642 GGGTGACTTTGAATAGAATGGGG - Intergenic
1059364391 9:113774675-113774697 GGGTTATTTGGGAGTGAAGTTGG - Intergenic
1059430896 9:114249769-114249791 GGGTGAATTAGGAAAGATGGAGG - Intronic
1059930578 9:119256304-119256326 GGGTGATAGTGGATAGATGGTGG + Intronic
1060506566 9:124202361-124202383 GGGTGATTTTGGAGAGGCCCGGG + Intergenic
1060697755 9:125723865-125723887 GTGTGACTTTGGAGGGCAGGGGG - Intergenic
1061212763 9:129203203-129203225 GGGTGATGTTTGAGAGAGGAGGG - Intergenic
1062255730 9:135619871-135619893 GGGGGAGATTGGGGAGAAGGGGG - Intergenic
1062653681 9:137590974-137590996 GGGTGTTTCTGGAGAGACAGCGG + Intergenic
1062671443 9:137712202-137712224 GGGTGACCAGGGAGAGAAGGGGG - Intronic
1186046401 X:5541475-5541497 GGGTGACTTTGAATAGAATGGGG + Intergenic
1186411520 X:9348379-9348401 TGGAGATATTGGTGAGAAGGGGG - Intergenic
1186490442 X:9968109-9968131 GGGTAGTTTGGGACAGAAGGTGG + Intergenic
1188674015 X:32916194-32916216 GTTCTATTTTGGAGAGAAGGAGG - Intronic
1188822189 X:34789242-34789264 GGGTGATTCTGGTGAGAACTTGG - Intergenic
1189548903 X:42072746-42072768 GGATGATTTGGGAGAGTTGGGGG - Intergenic
1191799430 X:65061308-65061330 GGGGGATGTTGGACAAAAGGAGG - Intergenic
1192478810 X:71467162-71467184 GGATAATAGTGGAGAGAAGGTGG + Intronic
1192735907 X:73849787-73849809 GAGTGACTTTCGAGAGAAGCTGG + Intergenic
1192803199 X:74486584-74486606 AGGTGACTTTGGAGAGGATGTGG + Intronic
1196987672 X:121292885-121292907 TGGTGATTCTGGAGGGAGGGGGG - Intergenic
1198249943 X:134870315-134870337 GGGTGAATGTGCAGAGAAGTGGG + Intergenic
1198329100 X:135605177-135605199 GAGTATTTTTGGAGAGAGGGAGG - Intergenic
1198361741 X:135902408-135902430 GAGTATTTTTGGAGAGAGGGAGG - Intronic
1198651581 X:138869031-138869053 GGGTGGTTATGGAAAGATGGAGG - Intronic
1199673220 X:150163747-150163769 GGGCAATGGTGGAGAGAAGGAGG + Intergenic
1201614629 Y:15883535-15883557 GGCTGATTTTGGAGGGAAGTTGG + Intergenic
1201615739 Y:15896242-15896264 GGCTGATTTTGGAGGGAAGTTGG - Intergenic
1201634289 Y:16104965-16104987 GAGTGATGTGGCAGAGAAGGAGG + Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic