ID: 1086112011

View in Genome Browser
Species Human (GRCh38)
Location 11:83209350-83209372
Sequence TGCTTGGAGGTTGGCAGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 4, 3: 14, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086112004_1086112011 10 Left 1086112004 11:83209317-83209339 CCAAAGTGGGTGGGAGTGCGTGC 0: 1
1: 1
2: 0
3: 9
4: 345
Right 1086112011 11:83209350-83209372 TGCTTGGAGGTTGGCAGCGCGGG 0: 1
1: 1
2: 4
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086112011 Original CRISPR TGCTTGGAGGTTGGCAGCGC GGG Intronic