ID: 1086113072

View in Genome Browser
Species Human (GRCh38)
Location 11:83219476-83219498
Sequence GCGTATAGTAAGTTTAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086113063_1086113072 29 Left 1086113063 11:83219424-83219446 CCTGGCCATAAAACTGTCCTTCA 0: 8
1: 6
2: 3
3: 13
4: 226
Right 1086113072 11:83219476-83219498 GCGTATAGTAAGTTTAAAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1086113065_1086113072 24 Left 1086113065 11:83219429-83219451 CCATAAAACTGTCCTTCAAGGAG 0: 8
1: 7
2: 6
3: 22
4: 202
Right 1086113072 11:83219476-83219498 GCGTATAGTAAGTTTAAAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1086113066_1086113072 12 Left 1086113066 11:83219441-83219463 CCTTCAAGGAGAAATCTCTGAAT 0: 11
1: 8
2: 2
3: 19
4: 233
Right 1086113072 11:83219476-83219498 GCGTATAGTAAGTTTAAAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086113072 Original CRISPR GCGTATAGTAAGTTTAAAGG GGG Intronic
908823759 1:68114459-68114481 GCATATAGTAAGTTTTAAAAAGG - Intronic
909586666 1:77297779-77297801 GAGTATACTAAGTTTAACTGTGG + Intronic
910321139 1:85945724-85945746 GCCTATAGGAAGTCTGAAGGTGG - Intronic
916195305 1:162216923-162216945 ACATATAGCAAATTTAAAGGTGG + Intronic
920681851 1:208079137-208079159 GCGTACAGTGAGTTTAATGTGGG - Intronic
922888928 1:229045749-229045771 GCAGATAGAAAGTTGAAAGGGGG + Intergenic
923693182 1:236217436-236217458 GGGGAGAGTAAGCTTAAAGGAGG + Exonic
924769382 1:247065594-247065616 GTGCAGAGTATGTTTAAAGGGGG + Intronic
1064670044 10:17704024-17704046 ACGCATTGTAAGTTTAAATGTGG + Intronic
1073842871 10:107518214-107518236 GCGTATAGTAAAGTTAGAAGAGG - Intergenic
1079724112 11:23858546-23858568 TCTTATAGTAAGTTTGAAGTTGG - Intergenic
1085502748 11:77038248-77038270 GCGTAGAGTCTGTTTTAAGGAGG + Intronic
1086113072 11:83219476-83219498 GCGTATAGTAAGTTTAAAGGGGG + Intronic
1091008957 11:131981016-131981038 GTTTATAATAAGTTTAAATGAGG + Intronic
1096782364 12:53998615-53998637 GGGTAGAGTGAATTTAAAGGAGG - Intronic
1097587869 12:61536580-61536602 GCGTATACTTCATTTAAAGGGGG - Intergenic
1101543446 12:105685857-105685879 GAGTATAGAAAGTATAAAGCAGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1107499438 13:40957903-40957925 CTGAATAGTAAGTCTAAAGGCGG - Intronic
1118696783 14:68393777-68393799 GAGTAAAGGAAGTTAAAAGGGGG - Intronic
1120483012 14:85076167-85076189 GTGTTTAGTATGTTTAATGGTGG - Intergenic
1120658645 14:87227032-87227054 GAGGATAGTAGGTTTAAATGAGG - Intergenic
1125431971 15:39604551-39604573 GTGTATAGTAAGTTTATATTTGG - Intronic
1138831435 16:60379636-60379658 GAGTTTAGAAAGTTCAAAGGAGG + Intergenic
1139202478 16:64992328-64992350 GTGCATATTAAGTTTAAAGCAGG + Intronic
1142830785 17:2547535-2547557 GCGTATACTAGTTTTAAGGGAGG + Intergenic
1151640860 17:75392696-75392718 GAGTATGTTAACTTTAAAGGAGG - Intronic
1153095677 18:1399472-1399494 TTGTTTAGTAAGTTTAAAGGAGG + Intergenic
928918595 2:36501771-36501793 GCTTATAGGAAATTTAAAGATGG - Intronic
929177434 2:38994901-38994923 ACGTATAATAAATTTAAAGAGGG + Intronic
939973462 2:148688844-148688866 GCATAAAGTAAGTTCCAAGGAGG - Intronic
940043222 2:149382067-149382089 GTGTATAGCAAGTTTTAATGGGG + Intronic
944468232 2:200025183-200025205 GCACATAGGAAGTCTAAAGGGGG - Intergenic
945444407 2:209918883-209918905 GCTTTTAGTAGCTTTAAAGGTGG - Intronic
951014702 3:17717846-17717868 GTGCATAGTAAGTGTAAAGGTGG - Intronic
951984001 3:28597774-28597796 GGGTATAGGAAGTATAAAAGAGG + Intergenic
956633349 3:71338013-71338035 GCTCATAGTAAGTATTAAGGAGG + Intronic
966829939 3:183999170-183999192 GCATATAGTTAGTTTCAAGTGGG - Intronic
975004402 4:69268601-69268623 AGGTTTAGTAAGCTTAAAGGAGG - Intergenic
976754768 4:88486231-88486253 AGGTATAGCATGTTTAAAGGGGG + Intronic
981218891 4:142207954-142207976 GAGTATAGTAAGGTAGAAGGTGG - Intronic
983318384 4:166163379-166163401 GTGTTAAGTAAGTTTAAAGTGGG - Intergenic
986408927 5:7457152-7457174 GAGTATAGTAAATTTCAAGTAGG - Intronic
992704406 5:79374999-79375021 GTGTATAGCTATTTTAAAGGGGG - Exonic
995578102 5:113563040-113563062 GAATGTAGTAAGTATAAAGGGGG + Intronic
1010166190 6:72917851-72917873 GGGTATAGTAACTTGAAGGGTGG - Intronic
1018400880 6:163417793-163417815 GCATATAGTATGTTTAAAATGGG + Intronic
1034545889 7:151789052-151789074 CCTTATAGTAAGTTTAAAATTGG + Intronic
1035613126 8:982023-982045 GAGCAAAGCAAGTTTAAAGGTGG - Intergenic
1041524240 8:58787937-58787959 GCATATAGTAATTTCAAAAGGGG + Intergenic
1186502541 X:10063747-10063769 GCATATAATATGTTTAATGGAGG + Intronic
1198022099 X:132669185-132669207 GGGTATAGTAAGGATAAACGGGG - Exonic