ID: 1086119019

View in Genome Browser
Species Human (GRCh38)
Location 11:83286278-83286300
Sequence TTGGACTATGCCCCACTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086119019_1086119034 28 Left 1086119019 11:83286278-83286300 CCTGGCAGTGGGGCATAGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1086119034 11:83286329-83286351 CCATTACGCGCTTGGGTCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 12
1086119019_1086119031 26 Left 1086119019 11:83286278-83286300 CCTGGCAGTGGGGCATAGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1086119031 11:83286327-83286349 GGCCATTACGCGCTTGGGTCGGG 0: 1
1: 0
2: 0
3: 1
4: 19
1086119019_1086119029 21 Left 1086119019 11:83286278-83286300 CCTGGCAGTGGGGCATAGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1086119029 11:83286322-83286344 CCAGCGGCCATTACGCGCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 19
1086119019_1086119030 25 Left 1086119019 11:83286278-83286300 CCTGGCAGTGGGGCATAGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1086119030 11:83286326-83286348 CGGCCATTACGCGCTTGGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119019_1086119032 27 Left 1086119019 11:83286278-83286300 CCTGGCAGTGGGGCATAGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1086119032 11:83286328-83286350 GCCATTACGCGCTTGGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119019_1086119027 20 Left 1086119019 11:83286278-83286300 CCTGGCAGTGGGGCATAGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1086119027 11:83286321-83286343 GCCAGCGGCCATTACGCGCTTGG 0: 1
1: 0
2: 0
3: 0
4: 28
1086119019_1086119022 5 Left 1086119019 11:83286278-83286300 CCTGGCAGTGGGGCATAGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1086119022 11:83286306-83286328 GGCTCCCCCAAGATAGCCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086119019 Original CRISPR TTGGACTATGCCCCACTGCC AGG (reversed) Exonic