ID: 1086119021

View in Genome Browser
Species Human (GRCh38)
Location 11:83286297-83286319
Sequence ATCTTGGGGGAGCCAGCTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086119021_1086119027 1 Left 1086119021 11:83286297-83286319 CCAACAGCTGGCTCCCCCAAGAT 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1086119027 11:83286321-83286343 GCCAGCGGCCATTACGCGCTTGG 0: 1
1: 0
2: 0
3: 0
4: 28
1086119021_1086119029 2 Left 1086119021 11:83286297-83286319 CCAACAGCTGGCTCCCCCAAGAT 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1086119029 11:83286322-83286344 CCAGCGGCCATTACGCGCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 19
1086119021_1086119030 6 Left 1086119021 11:83286297-83286319 CCAACAGCTGGCTCCCCCAAGAT 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1086119030 11:83286326-83286348 CGGCCATTACGCGCTTGGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119021_1086119034 9 Left 1086119021 11:83286297-83286319 CCAACAGCTGGCTCCCCCAAGAT 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1086119034 11:83286329-83286351 CCATTACGCGCTTGGGTCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 12
1086119021_1086119032 8 Left 1086119021 11:83286297-83286319 CCAACAGCTGGCTCCCCCAAGAT 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1086119032 11:83286328-83286350 GCCATTACGCGCTTGGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119021_1086119031 7 Left 1086119021 11:83286297-83286319 CCAACAGCTGGCTCCCCCAAGAT 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1086119031 11:83286327-83286349 GGCCATTACGCGCTTGGGTCGGG 0: 1
1: 0
2: 0
3: 1
4: 19
1086119021_1086119035 15 Left 1086119021 11:83286297-83286319 CCAACAGCTGGCTCCCCCAAGAT 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1086119035 11:83286335-83286357 CGCGCTTGGGTCGGGGGAGATGG 0: 1
1: 0
2: 0
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086119021 Original CRISPR ATCTTGGGGGAGCCAGCTGT TGG (reversed) Exonic