ID: 1086119026

View in Genome Browser
Species Human (GRCh38)
Location 11:83286313-83286335
Sequence GTAATGGCCGCTGGCTATCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086119026_1086119036 27 Left 1086119026 11:83286313-83286335 CCAAGATAGCCAGCGGCCATTAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1086119036 11:83286363-83286385 CATTTAGCCGCACAGCAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 101
1086119026_1086119032 -8 Left 1086119026 11:83286313-83286335 CCAAGATAGCCAGCGGCCATTAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1086119032 11:83286328-83286350 GCCATTACGCGCTTGGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119026_1086119035 -1 Left 1086119026 11:83286313-83286335 CCAAGATAGCCAGCGGCCATTAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1086119035 11:83286335-83286357 CGCGCTTGGGTCGGGGGAGATGG 0: 1
1: 0
2: 0
3: 6
4: 141
1086119026_1086119030 -10 Left 1086119026 11:83286313-83286335 CCAAGATAGCCAGCGGCCATTAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1086119030 11:83286326-83286348 CGGCCATTACGCGCTTGGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119026_1086119034 -7 Left 1086119026 11:83286313-83286335 CCAAGATAGCCAGCGGCCATTAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1086119034 11:83286329-83286351 CCATTACGCGCTTGGGTCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 12
1086119026_1086119031 -9 Left 1086119026 11:83286313-83286335 CCAAGATAGCCAGCGGCCATTAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1086119031 11:83286327-83286349 GGCCATTACGCGCTTGGGTCGGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086119026 Original CRISPR GTAATGGCCGCTGGCTATCT TGG (reversed) Exonic