ID: 1086119032

View in Genome Browser
Species Human (GRCh38)
Location 11:83286328-83286350
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 7}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086119026_1086119032 -8 Left 1086119026 11:83286313-83286335 CCAAGATAGCCAGCGGCCATTAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1086119032 11:83286328-83286350 GCCATTACGCGCTTGGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119024_1086119032 -6 Left 1086119024 11:83286311-83286333 CCCCAAGATAGCCAGCGGCCATT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1086119032 11:83286328-83286350 GCCATTACGCGCTTGGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119021_1086119032 8 Left 1086119021 11:83286297-83286319 CCAACAGCTGGCTCCCCCAAGAT 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1086119032 11:83286328-83286350 GCCATTACGCGCTTGGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119025_1086119032 -7 Left 1086119025 11:83286312-83286334 CCCAAGATAGCCAGCGGCCATTA 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1086119032 11:83286328-83286350 GCCATTACGCGCTTGGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119023_1086119032 -5 Left 1086119023 11:83286310-83286332 CCCCCAAGATAGCCAGCGGCCAT 0: 1
1: 0
2: 1
3: 2
4: 70
Right 1086119032 11:83286328-83286350 GCCATTACGCGCTTGGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 7
1086119019_1086119032 27 Left 1086119019 11:83286278-83286300 CCTGGCAGTGGGGCATAGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1086119032 11:83286328-83286350 GCCATTACGCGCTTGGGTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type