ID: 1086119036

View in Genome Browser
Species Human (GRCh38)
Location 11:83286363-83286385
Sequence CATTTAGCCGCACAGCAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086119028_1086119036 18 Left 1086119028 11:83286322-83286344 CCAGCGGCCATTACGCGCTTGGG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1086119036 11:83286363-83286385 CATTTAGCCGCACAGCAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 101
1086119023_1086119036 30 Left 1086119023 11:83286310-83286332 CCCCCAAGATAGCCAGCGGCCAT 0: 1
1: 0
2: 1
3: 2
4: 70
Right 1086119036 11:83286363-83286385 CATTTAGCCGCACAGCAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 101
1086119025_1086119036 28 Left 1086119025 11:83286312-83286334 CCCAAGATAGCCAGCGGCCATTA 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1086119036 11:83286363-83286385 CATTTAGCCGCACAGCAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 101
1086119024_1086119036 29 Left 1086119024 11:83286311-83286333 CCCCAAGATAGCCAGCGGCCATT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1086119036 11:83286363-83286385 CATTTAGCCGCACAGCAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 101
1086119033_1086119036 11 Left 1086119033 11:83286329-83286351 CCATTACGCGCTTGGGTCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1086119036 11:83286363-83286385 CATTTAGCCGCACAGCAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 101
1086119026_1086119036 27 Left 1086119026 11:83286313-83286335 CCAAGATAGCCAGCGGCCATTAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1086119036 11:83286363-83286385 CATTTAGCCGCACAGCAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086119036 Original CRISPR CATTTAGCCGCACAGCAGCC TGG Exonic