ID: 1086119953

View in Genome Browser
Species Human (GRCh38)
Location 11:83295320-83295342
Sequence GAAGCTATTGTTAAATGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086119953_1086119960 -1 Left 1086119953 11:83295320-83295342 CCCACCCATTTAACAATAGCTTC No data
Right 1086119960 11:83295342-83295364 CAACTTACTGAGGGTTTAGTGGG No data
1086119953_1086119959 -2 Left 1086119953 11:83295320-83295342 CCCACCCATTTAACAATAGCTTC No data
Right 1086119959 11:83295341-83295363 TCAACTTACTGAGGGTTTAGTGG No data
1086119953_1086119958 -10 Left 1086119953 11:83295320-83295342 CCCACCCATTTAACAATAGCTTC No data
Right 1086119958 11:83295333-83295355 CAATAGCTTCAACTTACTGAGGG No data
1086119953_1086119961 6 Left 1086119953 11:83295320-83295342 CCCACCCATTTAACAATAGCTTC No data
Right 1086119961 11:83295349-83295371 CTGAGGGTTTAGTGGGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086119953 Original CRISPR GAAGCTATTGTTAAATGGGT GGG (reversed) Intergenic
No off target data available for this crispr