ID: 1086119957

View in Genome Browser
Species Human (GRCh38)
Location 11:83295332-83295354
Sequence ACAATAGCTTCAACTTACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086119951_1086119957 9 Left 1086119951 11:83295300-83295322 CCTTCCTTGCTGAAATTGTTCCC No data
Right 1086119957 11:83295332-83295354 ACAATAGCTTCAACTTACTGAGG No data
1086119949_1086119957 14 Left 1086119949 11:83295295-83295317 CCTTCCCTTCCTTGCTGAAATTG No data
Right 1086119957 11:83295332-83295354 ACAATAGCTTCAACTTACTGAGG No data
1086119950_1086119957 10 Left 1086119950 11:83295299-83295321 CCCTTCCTTGCTGAAATTGTTCC No data
Right 1086119957 11:83295332-83295354 ACAATAGCTTCAACTTACTGAGG No data
1086119952_1086119957 5 Left 1086119952 11:83295304-83295326 CCTTGCTGAAATTGTTCCCACCC No data
Right 1086119957 11:83295332-83295354 ACAATAGCTTCAACTTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086119957 Original CRISPR ACAATAGCTTCAACTTACTG AGG Intergenic
No off target data available for this crispr