ID: 1086119958

View in Genome Browser
Species Human (GRCh38)
Location 11:83295333-83295355
Sequence CAATAGCTTCAACTTACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086119952_1086119958 6 Left 1086119952 11:83295304-83295326 CCTTGCTGAAATTGTTCCCACCC No data
Right 1086119958 11:83295333-83295355 CAATAGCTTCAACTTACTGAGGG No data
1086119950_1086119958 11 Left 1086119950 11:83295299-83295321 CCCTTCCTTGCTGAAATTGTTCC No data
Right 1086119958 11:83295333-83295355 CAATAGCTTCAACTTACTGAGGG No data
1086119949_1086119958 15 Left 1086119949 11:83295295-83295317 CCTTCCCTTCCTTGCTGAAATTG No data
Right 1086119958 11:83295333-83295355 CAATAGCTTCAACTTACTGAGGG No data
1086119953_1086119958 -10 Left 1086119953 11:83295320-83295342 CCCACCCATTTAACAATAGCTTC No data
Right 1086119958 11:83295333-83295355 CAATAGCTTCAACTTACTGAGGG No data
1086119951_1086119958 10 Left 1086119951 11:83295300-83295322 CCTTCCTTGCTGAAATTGTTCCC No data
Right 1086119958 11:83295333-83295355 CAATAGCTTCAACTTACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086119958 Original CRISPR CAATAGCTTCAACTTACTGA GGG Intergenic
No off target data available for this crispr