ID: 1086119959

View in Genome Browser
Species Human (GRCh38)
Location 11:83295341-83295363
Sequence TCAACTTACTGAGGGTTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086119956_1086119959 -7 Left 1086119956 11:83295325-83295347 CCATTTAACAATAGCTTCAACTT No data
Right 1086119959 11:83295341-83295363 TCAACTTACTGAGGGTTTAGTGG No data
1086119953_1086119959 -2 Left 1086119953 11:83295320-83295342 CCCACCCATTTAACAATAGCTTC No data
Right 1086119959 11:83295341-83295363 TCAACTTACTGAGGGTTTAGTGG No data
1086119951_1086119959 18 Left 1086119951 11:83295300-83295322 CCTTCCTTGCTGAAATTGTTCCC No data
Right 1086119959 11:83295341-83295363 TCAACTTACTGAGGGTTTAGTGG No data
1086119955_1086119959 -6 Left 1086119955 11:83295324-83295346 CCCATTTAACAATAGCTTCAACT No data
Right 1086119959 11:83295341-83295363 TCAACTTACTGAGGGTTTAGTGG No data
1086119954_1086119959 -3 Left 1086119954 11:83295321-83295343 CCACCCATTTAACAATAGCTTCA No data
Right 1086119959 11:83295341-83295363 TCAACTTACTGAGGGTTTAGTGG No data
1086119949_1086119959 23 Left 1086119949 11:83295295-83295317 CCTTCCCTTCCTTGCTGAAATTG No data
Right 1086119959 11:83295341-83295363 TCAACTTACTGAGGGTTTAGTGG No data
1086119950_1086119959 19 Left 1086119950 11:83295299-83295321 CCCTTCCTTGCTGAAATTGTTCC No data
Right 1086119959 11:83295341-83295363 TCAACTTACTGAGGGTTTAGTGG No data
1086119952_1086119959 14 Left 1086119952 11:83295304-83295326 CCTTGCTGAAATTGTTCCCACCC No data
Right 1086119959 11:83295341-83295363 TCAACTTACTGAGGGTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086119959 Original CRISPR TCAACTTACTGAGGGTTTAG TGG Intergenic
No off target data available for this crispr