ID: 1086119961

View in Genome Browser
Species Human (GRCh38)
Location 11:83295349-83295371
Sequence CTGAGGGTTTAGTGGGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086119950_1086119961 27 Left 1086119950 11:83295299-83295321 CCCTTCCTTGCTGAAATTGTTCC No data
Right 1086119961 11:83295349-83295371 CTGAGGGTTTAGTGGGTACCAGG No data
1086119952_1086119961 22 Left 1086119952 11:83295304-83295326 CCTTGCTGAAATTGTTCCCACCC No data
Right 1086119961 11:83295349-83295371 CTGAGGGTTTAGTGGGTACCAGG No data
1086119956_1086119961 1 Left 1086119956 11:83295325-83295347 CCATTTAACAATAGCTTCAACTT No data
Right 1086119961 11:83295349-83295371 CTGAGGGTTTAGTGGGTACCAGG No data
1086119953_1086119961 6 Left 1086119953 11:83295320-83295342 CCCACCCATTTAACAATAGCTTC No data
Right 1086119961 11:83295349-83295371 CTGAGGGTTTAGTGGGTACCAGG No data
1086119951_1086119961 26 Left 1086119951 11:83295300-83295322 CCTTCCTTGCTGAAATTGTTCCC No data
Right 1086119961 11:83295349-83295371 CTGAGGGTTTAGTGGGTACCAGG No data
1086119954_1086119961 5 Left 1086119954 11:83295321-83295343 CCACCCATTTAACAATAGCTTCA No data
Right 1086119961 11:83295349-83295371 CTGAGGGTTTAGTGGGTACCAGG No data
1086119955_1086119961 2 Left 1086119955 11:83295324-83295346 CCCATTTAACAATAGCTTCAACT No data
Right 1086119961 11:83295349-83295371 CTGAGGGTTTAGTGGGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086119961 Original CRISPR CTGAGGGTTTAGTGGGTACC AGG Intergenic
No off target data available for this crispr