ID: 1086126232

View in Genome Browser
Species Human (GRCh38)
Location 11:83351303-83351325
Sequence GGCCTACAGCCTGAACTTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086126220_1086126232 30 Left 1086126220 11:83351250-83351272 CCATCATGCCCACCCTCATCTCT No data
Right 1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG No data
1086126224_1086126232 17 Left 1086126224 11:83351263-83351285 CCTCATCTCTGACTAGCACCTAT No data
Right 1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG No data
1086126222_1086126232 21 Left 1086126222 11:83351259-83351281 CCACCCTCATCTCTGACTAGCAC No data
Right 1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG No data
1086126226_1086126232 -1 Left 1086126226 11:83351281-83351303 CCTATTCCCAAGGCCTTAACTCG No data
Right 1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG No data
1086126229_1086126232 -8 Left 1086126229 11:83351288-83351310 CCAAGGCCTTAACTCGGCCTACA No data
Right 1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG No data
1086126221_1086126232 22 Left 1086126221 11:83351258-83351280 CCCACCCTCATCTCTGACTAGCA No data
Right 1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG No data
1086126228_1086126232 -7 Left 1086126228 11:83351287-83351309 CCCAAGGCCTTAACTCGGCCTAC No data
Right 1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG No data
1086126223_1086126232 18 Left 1086126223 11:83351262-83351284 CCCTCATCTCTGACTAGCACCTA No data
Right 1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086126232 Original CRISPR GGCCTACAGCCTGAACTTTC GGG Intergenic
No off target data available for this crispr