ID: 1086127695

View in Genome Browser
Species Human (GRCh38)
Location 11:83366115-83366137
Sequence AGACATTTGTTCATTCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086127695_1086127699 14 Left 1086127695 11:83366115-83366137 CCACTAGGAATGAACAAATGTCT No data
Right 1086127699 11:83366152-83366174 TTGGAGACAGGGTCTCACTCTGG 0: 8
1: 185
2: 506
3: 961
4: 1685
1086127695_1086127696 -5 Left 1086127695 11:83366115-83366137 CCACTAGGAATGAACAAATGTCT No data
Right 1086127696 11:83366133-83366155 TGTCTTCTTTTTTTTTTTTTTGG 0: 6
1: 106
2: 1748
3: 20080
4: 32538
1086127695_1086127698 3 Left 1086127695 11:83366115-83366137 CCACTAGGAATGAACAAATGTCT No data
Right 1086127698 11:83366141-83366163 TTTTTTTTTTTTTGGAGACAGGG 0: 1071
1: 15954
2: 24674
3: 55636
4: 213624
1086127695_1086127700 24 Left 1086127695 11:83366115-83366137 CCACTAGGAATGAACAAATGTCT No data
Right 1086127700 11:83366162-83366184 GGTCTCACTCTGGAGTGCAATGG No data
1086127695_1086127697 2 Left 1086127695 11:83366115-83366137 CCACTAGGAATGAACAAATGTCT No data
Right 1086127697 11:83366140-83366162 TTTTTTTTTTTTTTGGAGACAGG 0: 1057
1: 15552
2: 22473
3: 44095
4: 105224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086127695 Original CRISPR AGACATTTGTTCATTCCTAG TGG (reversed) Intergenic
No off target data available for this crispr