ID: 1086130243

View in Genome Browser
Species Human (GRCh38)
Location 11:83393942-83393964
Sequence GTGGGGAGAGGCCCACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086130243_1086130251 29 Left 1086130243 11:83393942-83393964 CCTGGTTGTGGGCCTCTCCCCAC No data
Right 1086130251 11:83393994-83394016 GTTTTTAAAAGAAGGGTGATTGG No data
1086130243_1086130249 21 Left 1086130243 11:83393942-83393964 CCTGGTTGTGGGCCTCTCCCCAC No data
Right 1086130249 11:83393986-83394008 TGCTAGACGTTTTTAAAAGAAGG No data
1086130243_1086130250 22 Left 1086130243 11:83393942-83393964 CCTGGTTGTGGGCCTCTCCCCAC No data
Right 1086130250 11:83393987-83394009 GCTAGACGTTTTTAAAAGAAGGG No data
1086130243_1086130252 30 Left 1086130243 11:83393942-83393964 CCTGGTTGTGGGCCTCTCCCCAC No data
Right 1086130252 11:83393995-83394017 TTTTTAAAAGAAGGGTGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086130243 Original CRISPR GTGGGGAGAGGCCCACAACC AGG (reversed) Intergenic