ID: 1086139344

View in Genome Browser
Species Human (GRCh38)
Location 11:83477541-83477563
Sequence TATCCTGGAGTTACACATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086139344_1086139347 16 Left 1086139344 11:83477541-83477563 CCACGATGTGTAACTCCAGGATA 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1086139347 11:83477580-83477602 CTCCAGACTGTGAAACACAATGG 0: 1
1: 0
2: 2
3: 21
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086139344 Original CRISPR TATCCTGGAGTTACACATCG TGG (reversed) Intronic
901219394 1:7574567-7574589 GATCCTGGAGTTAAAAATAGAGG - Intronic
907847284 1:58220432-58220454 TTTCCTGGAGTGACATCTCGTGG - Intronic
914355653 1:146882123-146882145 TATCCACGAGTGACACATCAGGG - Intergenic
1066255462 10:33674524-33674546 GATCCTGGAAGTACACATCATGG + Intergenic
1075235709 10:120726581-120726603 TATCCTAGAATTACAGACCGTGG + Intergenic
1079309087 11:19348495-19348517 TTGCCTAGAGTTACACAGCGAGG - Intergenic
1080858895 11:36135992-36136014 TTTCTTGGAGTTACATCTCGTGG + Intronic
1086139344 11:83477541-83477563 TATCCTGGAGTTACACATCGTGG - Intronic
1086353592 11:85968799-85968821 TATCATGAAGTTAAACATCTAGG + Intronic
1091783119 12:3226222-3226244 TATCCTCTAGTTGCACATAGCGG + Intronic
1101210304 12:102528912-102528934 GATCCTGGAGATCCACATCCTGG + Intergenic
1101617068 12:106348275-106348297 TATCCTGGAATTACTCTTCTTGG + Intergenic
1101997345 12:109534572-109534594 TGTCCTGAAGGCACACATCGTGG - Exonic
1113635121 13:111914168-111914190 GTTACTGGAGTTACACATGGTGG + Intergenic
1120658589 14:87226211-87226233 TATCCTGGAGCTTCATATTGTGG + Intergenic
1135966213 16:27037308-27037330 TACCCTGGAGTTACACACCCTGG + Intergenic
1137510027 16:49091033-49091055 CATGCTGGAGTTACATATCATGG + Intergenic
1138338070 16:56268437-56268459 TCTCCTGGAGTGACACATTTGGG - Intronic
1139978364 16:70833320-70833342 TATCCACGAGTGACACATCAGGG + Intronic
1142535422 17:614170-614192 TGTCCTGGAGTTGCACAGCTGGG + Intronic
1146587808 17:34097719-34097741 TATCCATGAGTTCCACATCATGG - Intronic
1153946301 18:10020925-10020947 TATCCAGGAGTTAAACAGCCAGG - Intergenic
1155007523 18:21741579-21741601 ATTCCGGGAGTTACTCATCGGGG - Exonic
1156529305 18:37799447-37799469 GATCCTGGAGTTTCACCTCCAGG - Intergenic
1158909575 18:62046811-62046833 TATCCTTGGGTTCCACATCATGG - Intronic
1164675182 19:30095909-30095931 CATCCTGGGGTTTCACACCGTGG - Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166633209 19:44426014-44426036 TATCCTGGAGGAACACATGATGG + Intronic
1168357210 19:55708817-55708839 TATCCTGTAATTGCACATCATGG - Exonic
927899567 2:26809485-26809507 TATCCTGGGGTGACACATTCTGG - Intergenic
931503658 2:62899635-62899657 TATGCTGGAGTTCCACACTGAGG + Intronic
941965632 2:171297663-171297685 TATCATGGAGTTACGCAAAGAGG - Intergenic
942823521 2:180145241-180145263 CATCCTGGAGTTTCACATCATGG - Intergenic
1174006956 20:47418598-47418620 TTTCCTGGATTTTCACATCAAGG - Intergenic
1179001418 21:37463233-37463255 TATCCTGTAGTAACACATATTGG + Intronic
954975415 3:54689414-54689436 TGTCCTGGAGATACACATCTGGG - Intronic
962118275 3:132534934-132534956 ATTCCTGGAGTTCCACATCATGG - Intronic
964168908 3:153743586-153743608 TATGCTGAAGTTCCACATCAAGG - Intergenic
982466176 4:155735415-155735437 TATCTTGGATTTAAACATTGGGG + Intergenic
990243048 5:53834786-53834808 ACTTCTGGAGTTAGACATCGTGG + Intergenic
992330685 5:75714832-75714854 TTTCCTGGAGTTAAGCATTGTGG + Intronic
995619652 5:114010529-114010551 GATGCTGGAGTTGCACATGGTGG + Intergenic
997869513 5:137495149-137495171 TTCCCTGGAGTTACAGATCCAGG - Intronic
1017833400 6:158153050-158153072 TATCCGGGAGGGACACATTGTGG - Intronic
1024589701 7:50870738-50870760 ATTCCTGGAGTCACACATCCTGG + Intergenic
1025992319 7:66505368-66505390 TATCCTGTACTCACACATGGTGG - Intergenic
1031347880 7:120691686-120691708 TAACCTGGAGGTACACATTTAGG + Intronic
1041754577 8:61299962-61299984 TATCCTGATGTAAAACATCGGGG - Exonic
1047349527 8:124060427-124060449 TTTCCTGGAGGAACACAGCGTGG + Intronic
1199726218 X:150584994-150585016 CATCCAGGAGTTCCACATCTAGG - Intronic